Transcript: Human XM_024454184.1

PREDICTED: Homo sapiens solute carrier family 39 member 8 (SLC39A8), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC39A8 (64116)
Length:
1575
CDS:
4..1431

Additional Resources:

NCBI RefSeq record:
XM_024454184.1
NBCI Gene record:
SLC39A8 (64116)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024454184.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043691 CCTGTCAGTGACGATTATTAA pLKO.1 402 CDS 100% 15.000 10.500 N SLC39A8 n/a
2 TRCN0000300183 CCTGTCAGTGACGATTATTAA pLKO_005 402 CDS 100% 15.000 10.500 N SLC39A8 n/a
3 TRCN0000043690 CCTTGCTATTCAACTTCCTTT pLKO.1 1097 CDS 100% 4.950 3.465 N SLC39A8 n/a
4 TRCN0000300123 CCTTGCTATTCAACTTCCTTT pLKO_005 1097 CDS 100% 4.950 3.465 N SLC39A8 n/a
5 TRCN0000043688 GCCAAGTTCATGTACCTGTTT pLKO.1 858 CDS 100% 4.950 3.465 N SLC39A8 n/a
6 TRCN0000300124 GCCAAGTTCATGTACCTGTTT pLKO_005 858 CDS 100% 4.950 3.465 N SLC39A8 n/a
7 TRCN0000043689 GCTGCACTTCAACCAGTGTTT pLKO.1 207 CDS 100% 4.950 3.465 N SLC39A8 n/a
8 TRCN0000310564 GCTGCACTTCAACCAGTGTTT pLKO_005 207 CDS 100% 4.950 3.465 N SLC39A8 n/a
9 TRCN0000079555 CCAAACTGTCAGAAATAGGAA pLKO.1 887 CDS 100% 3.000 2.100 N Slc39a8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024454184.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03926 pDONR223 100% 92.1% 89.5% None (many diffs) n/a
2 ccsbBroad304_03926 pLX_304 0% 92.1% 89.5% V5 (many diffs) n/a
3 TRCN0000479659 GGATCTGAGCGCCTTTTTGGCCTC pLX_317 26.6% 92.1% 89.5% V5 (many diffs) n/a
Download CSV