Transcript: Human XM_024454323.1

PREDICTED: Homo sapiens LHFPL tetraspan subfamily member 2 (LHFPL2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LHFPL2 (10184)
Length:
5039
CDS:
680..1366

Additional Resources:

NCBI RefSeq record:
XM_024454323.1
NBCI Gene record:
LHFPL2 (10184)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024454323.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136304 GCAAGGAATTGCAGGTCTATT pLKO.1 1096 CDS 100% 13.200 18.480 N LHFPL2 n/a
2 TRCN0000412915 ATTATGCATCTGCCTACAAAC pLKO_005 1185 CDS 100% 10.800 15.120 N LHFPL2 n/a
3 TRCN0000435762 GGTCTGCAGTGCACATTATAA pLKO_005 1544 3UTR 100% 15.000 10.500 N LHFPL2 n/a
4 TRCN0000134968 CCAGGTTCAATGAAGGATAAT pLKO.1 1635 3UTR 100% 13.200 9.240 N LHFPL2 n/a
5 TRCN0000136097 CCCAGGTTCAATGAAGGATAA pLKO.1 1634 3UTR 100% 10.800 7.560 N LHFPL2 n/a
6 TRCN0000426621 TTGCAACCTCTAGTGACAAAG pLKO_005 1299 CDS 100% 10.800 7.560 N LHFPL2 n/a
7 TRCN0000135391 GTCTATTCCTTATCCTCGGTT pLKO.1 1110 CDS 100% 2.640 1.848 N LHFPL2 n/a
8 TRCN0000135540 GTGTGTACAGAGCATCATGAA pLKO.1 1045 CDS 100% 4.950 2.970 N LHFPL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024454323.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02343 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02343 pLX_304 0% 100% 100% V5 n/a
Download CSV