Transcript: Human XM_024454356.1

PREDICTED: Homo sapiens creatine kinase, mitochondrial 2 (CKMT2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CKMT2 (1160)
Length:
7207
CDS:
5457..7067

Additional Resources:

NCBI RefSeq record:
XM_024454356.1
NBCI Gene record:
CKMT2 (1160)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024454356.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219736 ATGAGCGCCTAGGATACATTT pLKO.1 6730 CDS 100% 13.200 18.480 N CKMT2 n/a
2 TRCN0000219735 ACGGATCTGGATGCATCAAAG pLKO.1 6234 CDS 100% 10.800 15.120 N CKMT2 n/a
3 TRCN0000006063 CCAGGGTAATCTCAATGGAAA pLKO.1 6613 CDS 100% 4.950 6.930 N CKMT2 n/a
4 TRCN0000006062 GAAACGAGTATTTGAGCGATT pLKO.1 6647 CDS 100% 4.050 5.670 N CKMT2 n/a
5 TRCN0000196618 GAACGGTTAATCCAAGAACGA pLKO.1 6690 CDS 100% 2.640 2.112 N CKMT2 n/a
6 TRCN0000219737 AGTCATCGATGGAGTCAATTA pLKO.1 6965 CDS 100% 13.200 9.240 N CKMT2 n/a
7 TRCN0000006061 CGTCATCAAACTAAGACACAA pLKO.1 6182 CDS 100% 4.950 3.465 N CKMT2 n/a
8 TRCN0000010992 GTCGCAGATGTGTACGACATT pLKO.1 6897 CDS 100% 4.950 3.465 N CKMT2 n/a
9 TRCN0000199482 GCAGAAAGTGTGTGCCGAGGT pLKO.1 5909 CDS 100% 0.720 0.504 N CKMT2 n/a
10 TRCN0000196397 GACCACTTTCTGTTTGATAAG pLKO.1 6477 CDS 100% 10.800 5.400 Y CKMT2 n/a
11 TRCN0000165205 GCCTCAGTTTCCTCATCTGTA pLKO.1 2198 5UTR 100% 4.950 2.475 Y YIF1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024454356.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00315 pDONR223 100% 78.1% 78.1% None 1_351del n/a
2 ccsbBroad304_00315 pLX_304 0% 78.1% 78.1% V5 1_351del n/a
3 TRCN0000491337 CAGTATGCTTATTATAATTAGTCT pLX_317 26.3% 78.1% 78.1% V5 1_351del n/a
4 ccsbBroadEn_14586 pDONR223 0% 78.1% 78.1% None 1_351del n/a
5 ccsbBroad304_14586 pLX_304 0% 78.1% 78.1% V5 1_351del n/a
6 TRCN0000480045 GTCAGCAACGCCTGAAGGCTCGAC pLX_317 26.3% 78.1% 78.1% V5 1_351del n/a
Download CSV