Transcript: Human XM_024454365.1

PREDICTED: Homo sapiens flavin containing dimethylaniline monoxygenase 3 (FMO3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FMO3 (2328)
Length:
1410
CDS:
182..1033

Additional Resources:

NCBI RefSeq record:
XM_024454365.1
NBCI Gene record:
FMO3 (2328)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024454365.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064485 CCTATTCTGTTAATCGCTGTT pLKO.1 995 CDS 100% 4.050 5.670 N FMO3 n/a
2 TRCN0000430445 TTCCACAGCAGGGACTATAAA pLKO_005 145 5UTR 100% 15.000 10.500 N FMO3 n/a
3 TRCN0000064487 GCAGAAACAATGAGATCATTT pLKO.1 468 CDS 100% 13.200 9.240 N FMO3 n/a
4 TRCN0000064483 GCTCTGAAATAGCCACTTTAA pLKO.1 1189 3UTR 100% 13.200 9.240 N FMO3 n/a
5 TRCN0000420182 GTGTTGACCTAATCATCATTT pLKO_005 1022 CDS 100% 13.200 9.240 N FMO3 n/a
6 TRCN0000413549 TTAAGAGAGCACTAATCATTT pLKO_005 1226 3UTR 100% 13.200 9.240 N FMO3 n/a
7 TRCN0000416346 GTGTGGCATTGTGTCCGTAAA pLKO_005 313 CDS 100% 10.800 7.560 N FMO3 n/a
8 TRCN0000064486 CGGCTGTCTTTGATGCTGTAA pLKO.1 44 5UTR 100% 4.950 3.465 N FMO3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024454365.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06218 pDONR223 100% 53.1% 48.6% None 0_1ins547;79_80ins200 n/a
2 ccsbBroad304_06218 pLX_304 0% 53.1% 48.6% V5 0_1ins547;79_80ins200 n/a
3 TRCN0000470816 TTTTGCTAGTCCCCAGGGCCCGAA pLX_317 28.5% 53.1% 48.6% V5 0_1ins547;79_80ins200 n/a
Download CSV