Transcript: Mouse XM_030243137.1

PREDICTED: Mus musculus predicted gene 4553 (Gm4553), mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Gm4553 (100043617)
Length:
1185
CDS:
43..897

Additional Resources:

NCBI RefSeq record:
XM_030243137.1
NBCI Gene record:
Gm4553 (100043617)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030243137.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098360 CCAAGAAGTACCTCTACTATT pLKO.1 904 3UTR 100% 13.200 6.600 Y Krtap5-2 n/a
2 TRCN0000098364 TCCTGTATGCTGCCAGTGTAA pLKO.1 870 CDS 100% 4.950 2.475 Y Krtap5-2 n/a
3 TRCN0000436596 TCTTCAGGCTGTGGGTCTTCT pLKO_005 736 CDS 100% 4.950 2.475 Y Krtap5-4 n/a
4 TRCN0000098463 GCTGCTGCAAGCCTGTGTGTT pLKO.1 119 CDS 100% 1.650 0.825 Y Krtap5-1 n/a
5 TRCN0000098464 GCTGCTGCAAGCCCTGCTGTT pLKO.1 770 CDS 100% 0.000 0.000 Y Krtap5-1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030243137.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05666 pDONR223 100% 37.5% 36.3% None (many diffs) n/a
2 ccsbBroad304_05666 pLX_304 0% 37.5% 36.3% V5 (many diffs) n/a
3 TRCN0000475440 ACCAAGCTTTGGTAAGATGTTTGA pLX_317 10.7% 37.5% 36.3% V5 (many diffs) n/a
Download CSV