Construct: ORF TRCN0000475440
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003816.1_s317c1
- Derived from:
- ccsbBroadEn_05666
- DNA Barcode:
- ACCAAGCTTTGGTAAGATGTTTGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KRTAP5-6 (440023)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475440
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 440023 | KRTAP5-6 | keratin associated protein 5-6 | NM_001012416.1 | 100% | 100% | |
| 2 | human | 440050 | KRTAP5-7 | keratin associated protein 5-7 | NM_001012503.2 | 72.7% | 73.9% | (many diffs) |
| 3 | human | 440021 | KRTAP5-2 | keratin associated protein 5-2 | NM_001004325.2 | 67.4% | 66.1% | (many diffs) |
| 4 | human | 440051 | KRTAP5-11 | keratin associated protein ... | NM_001005405.3 | 66.8% | 66.2% | (many diffs) |
| 5 | human | 57830 | KRTAP5-8 | keratin associated protein 5-8 | NM_021046.3 | 65.2% | 65.7% | (many diffs) |
| 6 | human | 3846 | KRTAP5-9 | keratin associated protein 5-9 | NM_005553.3 | 64.1% | 60.5% | (many diffs) |
| 7 | human | 387273 | KRTAP5-10 | keratin associated protein ... | NM_001012710.2 | 59.4% | 59.9% | (many diffs) |
| 8 | human | 439915 | KRTAP5-5 | keratin associated protein 5-5 | XM_006725534.2 | 53.3% | 53.8% | (many diffs) |
| 9 | human | 387267 | KRTAP5-4 | keratin associated protein 5-4 | NM_001347674.1 | 52% | 54.8% | (many diffs) |
| 10 | human | 439915 | KRTAP5-5 | keratin associated protein 5-5 | NM_001001480.2 | 50% | 50.2% | (many diffs) |
| 11 | human | 387266 | KRTAP5-3 | keratin associated protein 5-3 | NM_001012708.2 | 50% | 50% | (many diffs) |
| 12 | human | 387264 | KRTAP5-1 | keratin associated protein 5-1 | NM_001005922.1 | 42.3% | 41.7% | (many diffs) |
| 13 | human | 387267 | KRTAP5-4 | keratin associated protein 5-4 | NM_001012709.1 | 41.3% | 43.4% | (many diffs) |
| 14 | mouse | 105244938 | Gm40460 | predicted gene, 40460 | XM_017312478.1 | 46.4% | 44.8% | (many diffs) |
| 15 | mouse | 114666 | Krtap5-5 | keratin associated protein 5-5 | NM_001037822.1 | 46.1% | 43.6% | (many diffs) |
| 16 | mouse | 100043617 | Gm4553 | predicted gene 4553 | XM_030243137.1 | 37.5% | 36.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 456
- ORF length:
- 387
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gggctgctgt ggctgctctg gaggctgtgg ctccggctgt gggggctgtg 121 gctctggctg tgggggctgt gggtccagct gctgtgtgcc catctgctgc tgcaagcccg 181 tgtgctgctg tgtgccagcc tgttcctgca ccagctgtgg ctcttgtggg ggctccaagg 241 ggtgctgtgg ctcttgtggg ggctccaaag ggggctgtgg ctcttgtggg ggctccaagg 301 gaggctgtgg ctcttgtggc tgctcccagt gcagttgctg caagccctgc tactgttcct 361 caggctgtgg gtcatcctgc tgccagtcca gctgctgcaa gccctgctgt tcccaggcca 421 gcTGCTGTGT CCCCATTTGC TGCCAGTGCA AAATCTTGCC AACTTTCTTG TACAAAGTGG 481 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 541 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 601 AACCAAGCTT TGGTAAGATG TTTGAACGCG TTAAGTCgac aatcaacctc tggattacaa 661 aatttgtgaa agatt