Transcript: Mouse XM_030248019.1

PREDICTED: Mus musculus importin 5 (Ipo5), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Ipo5 (70572)
Length:
4597
CDS:
110..3403

Additional Resources:

NCBI RefSeq record:
XM_030248019.1
NBCI Gene record:
Ipo5 (70572)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030248019.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348328 TGACTAAAGTGTCGGATATTT pLKO_005 2625 CDS 100% 15.000 10.500 N Ipo5 n/a
2 TRCN0000101930 CGTCTCATTCACTCCTCAATA pLKO.1 3975 3UTR 100% 13.200 9.240 N Ipo5 n/a
3 TRCN0000334490 CGTCTCATTCACTCCTCAATA pLKO_005 3975 3UTR 100% 13.200 9.240 N Ipo5 n/a
4 TRCN0000101931 GCCCATGATTAAGGAACACAT pLKO.1 1177 CDS 100% 4.950 3.465 N Ipo5 n/a
5 TRCN0000334568 GCCCATGATTAAGGAACACAT pLKO_005 1177 CDS 100% 4.950 3.465 N Ipo5 n/a
6 TRCN0000101932 GCTTCATTTAAGTATGCAGAA pLKO.1 2801 CDS 100% 4.050 2.835 N Ipo5 n/a
7 TRCN0000203229 GCTTCATTTAAGTATGCAGAA pLKO.1 2801 CDS 100% 4.050 2.835 N Gm5133 n/a
8 TRCN0000101933 CCTGATTGGAAATACAGGCAT pLKO.1 1217 CDS 100% 2.640 1.848 N Ipo5 n/a
9 TRCN0000101934 GCTGCCTTCATACTTGCCAAT pLKO.1 701 CDS 100% 4.050 2.430 N Ipo5 n/a
10 TRCN0000334488 GCTGCCTTCATACTTGCCAAT pLKO_005 701 CDS 100% 4.050 2.430 N Ipo5 n/a
11 TRCN0000149838 CCCTTGTTGAGATTGCAGATA pLKO.1 825 CDS 100% 4.950 2.475 Y RANBP6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030248019.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10938 pDONR223 100% 89.7% 98.2% None (many diffs) n/a
2 ccsbBroad304_10938 pLX_304 0% 89.7% 98.2% V5 (many diffs) n/a
3 TRCN0000478234 TATAAATTTGACGCGGACTCTGGC pLX_317 9.8% 89.7% 98.2% V5 (many diffs) n/a
Download CSV