Transcript: Mouse XM_030248417.1

PREDICTED: Mus musculus POU domain, class 6, transcription factor 1 (Pou6f1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Pou6f1 (19009)
Length:
5032
CDS:
302..2077

Additional Resources:

NCBI RefSeq record:
XM_030248417.1
NBCI Gene record:
Pou6f1 (19009)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030248417.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075452 CCGTCAGTCAGTTGGTATCAA pLKO.1 1542 CDS 100% 5.625 7.875 N Pou6f1 n/a
2 TRCN0000315998 CCGTCAGTCAGTTGGTATCAA pLKO_005 1542 CDS 100% 5.625 7.875 N Pou6f1 n/a
3 TRCN0000075449 CGGGATCAACTTAGAAGAGAT pLKO.1 1591 CDS 100% 4.950 6.930 N Pou6f1 n/a
4 TRCN0000315996 CGGGATCAACTTAGAAGAGAT pLKO_005 1591 CDS 100% 4.950 6.930 N Pou6f1 n/a
5 TRCN0000310938 ATGCTCAGGGACAGGTTATTG pLKO_005 1203 CDS 100% 13.200 10.560 N Pou6f1 n/a
6 TRCN0000075450 CCGGGAGTTTGCTAAGAATTT pLKO.1 1612 CDS 100% 13.200 10.560 N Pou6f1 n/a
7 TRCN0000315997 CCGGGAGTTTGCTAAGAATTT pLKO_005 1612 CDS 100% 13.200 10.560 N Pou6f1 n/a
8 TRCN0000075448 GCCTCCCAAGAAAGAATAATT pLKO.1 4001 3UTR 100% 15.000 10.500 N Pou6f1 n/a
9 TRCN0000310937 TTCCGGTTGGGAACCAGAAAG pLKO_005 2356 3UTR 100% 10.800 7.560 N Pou6f1 n/a
10 TRCN0000075451 CAACCGTCAGTCAGTTGGTAT pLKO.1 1539 CDS 100% 4.950 3.465 N Pou6f1 n/a
11 TRCN0000017972 CCACAGTTCTGACAGGAGTTA pLKO.1 630 CDS 100% 4.950 3.465 N POU6F1 n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3933 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030248417.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01248 pDONR223 100% 44.8% 48.5% None (many diffs) n/a
2 ccsbBroad304_01248 pLX_304 0% 44.8% 48.5% V5 (many diffs) n/a
3 TRCN0000476325 GTCACTGTTAGTTGAGAACCACAG pLX_317 41.9% 44.8% 48.5% V5 (many diffs) n/a
Download CSV