Transcript: Mouse XM_030252386.1

PREDICTED: Mus musculus RAS-related protein 1a (Rap1a), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Rap1a (109905)
Length:
2361
CDS:
74..628

Additional Resources:

NCBI RefSeq record:
XM_030252386.1
NBCI Gene record:
Rap1a (109905)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030252386.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055269 GCTCAGTCTACGTTTAATGAT pLKO.1 329 CDS 100% 5.625 7.875 N Rap1a n/a
2 TRCN0000317277 GCTCAGTCTACGTTTAATGAT pLKO_005 329 CDS 100% 5.625 7.875 N Rap1a n/a
3 TRCN0000055268 GCCAAGGGTTTGCACTAGTTT pLKO.1 297 CDS 100% 0.000 0.000 N Rap1a n/a
4 TRCN0000317276 GCCAAGGGTTTGCACTAGTTT pLKO_005 297 CDS 100% 0.000 0.000 N Rap1a n/a
5 TRCN0000055271 CCGAGCAATTTACAGCAATGA pLKO.1 255 CDS 100% 4.950 3.960 N Rap1a n/a
6 TRCN0000055272 CGGGTAGTTGGCAAAGAACAA pLKO.1 443 CDS 100% 4.950 3.960 N Rap1a n/a
7 TRCN0000317206 CGGGTAGTTGGCAAAGAACAA pLKO_005 443 CDS 100% 4.950 3.960 N Rap1a n/a
8 TRCN0000029788 CCCAACGATAGAAGATTCCTA pLKO.1 172 CDS 100% 3.000 2.400 N RAP1A n/a
9 TRCN0000278853 CCCAACGATAGAAGATTCCTA pLKO_005 172 CDS 100% 3.000 2.400 N RAP1A n/a
10 TRCN0000347795 AGTCAAAGATCAACGTTAATG pLKO_005 519 CDS 100% 13.200 9.240 N Gm9392 n/a
11 TRCN0000029787 GCTCTGACAGTTCAGTTTGTT pLKO.1 125 CDS 100% 5.625 3.938 N RAP1A n/a
12 TRCN0000297571 GCTCTGACAGTTCAGTTTGTT pLKO_005 125 CDS 100% 5.625 3.938 N RAP1A n/a
13 TRCN0000055270 CAGTGGTGTAACTGTGCCTTT pLKO.1 482 CDS 100% 4.050 2.835 N Rap1a n/a
14 TRCN0000317279 CAGTGGTGTAACTGTGCCTTT pLKO_005 482 CDS 100% 4.050 2.835 N Rap1a n/a
15 TRCN0000347793 ACAGCTCAGTCTACGTTTAAT pLKO_005 326 CDS 100% 15.000 9.000 N Gm9392 n/a
16 TRCN0000347796 GACCTGGTCAGACAGATAAAT pLKO_005 551 CDS 100% 15.000 9.000 N Gm9392 n/a
17 TRCN0000029784 GCCAGCATTCCAGACTTCAAA pLKO.1 695 3UTR 100% 5.625 3.375 N RAP1A n/a
18 TRCN0000278917 GCCAGCATTCCAGACTTCAAA pLKO_005 695 3UTR 100% 5.625 3.375 N RAP1A n/a
19 TRCN0000272334 TTACAGCAATGAGGGATTTAT pLKO_005 264 CDS 100% 15.000 21.000 N RAP1BL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030252386.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01374 pDONR223 100% 94.2% 100% None (many diffs) n/a
2 ccsbBroad304_01374 pLX_304 0% 94.2% 100% V5 (many diffs) n/a
3 TRCN0000469486 TGTTACCAGGTTATACAGAGCGCG pLX_317 78.4% 94% 97.3% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV