Transcript: Mouse XM_030252463.1

PREDICTED: Mus musculus protein phosphatase 3, catalytic subunit, alpha isoform (Ppp3ca), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Ppp3ca (19055)
Length:
5268
CDS:
1354..2769

Additional Resources:

NCBI RefSeq record:
XM_030252463.1
NBCI Gene record:
Ppp3ca (19055)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030252463.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000342567 CAAGGGCTTAGACCGAATTAA pLKO_005 2622 CDS 100% 15.000 21.000 N PPP3CA n/a
2 TRCN0000002750 CACCACAACATAAGATCACTA pLKO.1 2588 CDS 100% 4.950 6.930 N PPP3CA n/a
3 TRCN0000081060 CGCCAACCTTAACTCCATCAA pLKO.1 2682 CDS 100% 4.950 6.930 N Ppp3ca n/a
4 TRCN0000309719 CGCCAACCTTAACTCCATCAA pLKO_005 2682 CDS 100% 4.950 6.930 N Ppp3ca n/a
5 TRCN0000081062 CACAGAGTATTTCACGTTTAA pLKO.1 1671 CDS 100% 13.200 10.560 N Ppp3ca n/a
6 TRCN0000309717 CACAGAGTATTTCACGTTTAA pLKO_005 1671 CDS 100% 13.200 10.560 N Ppp3ca n/a
7 TRCN0000081061 GCACAATAATTTGTTGTCCAT pLKO.1 2013 CDS 100% 2.640 2.112 N Ppp3ca n/a
8 TRCN0000081058 GCCAGGAATTGGATTCAGTTT pLKO.1 2878 3UTR 100% 4.950 3.465 N Ppp3ca n/a
9 TRCN0000309716 GCCAGGAATTGGATTCAGTTT pLKO_005 2878 3UTR 100% 4.950 3.465 N Ppp3ca n/a
10 TRCN0000081059 GCTGGAAGAAAGTGTTGCATT pLKO.1 1368 CDS 100% 4.950 3.465 N Ppp3ca n/a
11 TRCN0000309790 GCTGGAAGAAAGTGTTGCATT pLKO_005 1368 CDS 100% 4.950 3.465 N Ppp3ca n/a
12 TRCN0000002751 GCTGTATTTGTGGGCCTTGAA pLKO.1 1593 CDS 100% 4.950 3.465 N PPP3CA n/a
13 TRCN0000352645 GCTGTATTTGTGGGCCTTGAA pLKO_005 1593 CDS 100% 4.950 3.465 N PPP3CA n/a
14 TRCN0000002752 GAATAATAACAGAGGGTGCAT pLKO.1 1391 CDS 100% 2.640 3.696 N PPP3CA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030252463.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01266 pDONR223 100% 81.8% 88% None (many diffs) n/a
2 ccsbBroad304_01266 pLX_304 0% 81.8% 88% V5 (many diffs) n/a
3 TRCN0000472901 TCACCCGCGCCAACGTTTCGGTAA pLX_317 31.4% 81.8% 88% V5 (many diffs) n/a
Download CSV