Transcript: Mouse XM_030253232.1

PREDICTED: Mus musculus ELAV like RNA binding protein 1 (Elavl2), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Elavl2 (15569)
Length:
4358
CDS:
642..1811

Additional Resources:

NCBI RefSeq record:
XM_030253232.1
NBCI Gene record:
Elavl2 (15569)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030253232.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000319410 GGTGTAGGGTTTATTCGATTT pLKO_005 1227 CDS 100% 10.800 15.120 N Elavl2 n/a
2 TRCN0000112021 CGCCTGATGCAGATGAAAGTA pLKO.1 1582 CDS 100% 5.625 4.500 N Elavl2 n/a
3 TRCN0000112023 CAATGGTCCAACCACTGTAAA pLKO.1 773 CDS 100% 13.200 9.240 N Elavl2 n/a
4 TRCN0000317610 CAATGGTCCAACCACTGTAAA pLKO_005 773 CDS 100% 13.200 9.240 N Elavl2 n/a
5 TRCN0000021934 CCGTGACTTTAACACCAATAA pLKO.1 1655 CDS 100% 13.200 9.240 N ELAVL2 n/a
6 TRCN0000319424 CTCTTGTCCTCAGTCCATTTA pLKO_005 1816 3UTR 100% 13.200 9.240 N Elavl2 n/a
7 TRCN0000421130 CTCTTGTCCTCAGTCCATTTA pLKO_005 1816 3UTR 100% 13.200 9.240 N ELAVL2 n/a
8 TRCN0000319495 GAAGCTATCAAAGGCCTAAAT pLKO_005 1269 CDS 100% 13.200 9.240 N Elavl2 n/a
9 TRCN0000426674 GAAGCTATCAAAGGCCTAAAT pLKO_005 1269 CDS 100% 13.200 9.240 N ELAVL2 n/a
10 TRCN0000419651 GTTGGACAATCTGCTCAATAT pLKO_005 1442 CDS 100% 13.200 9.240 N ELAVL2 n/a
11 TRCN0000021936 GTCTCCTTTAAGACAAACAAA pLKO.1 1776 CDS 100% 5.625 3.938 N ELAVL2 n/a
12 TRCN0000112024 GAAAGCTATCAACACTCTGAA pLKO.1 1010 CDS 100% 4.950 3.465 N Elavl2 n/a
13 TRCN0000112022 GCAGGTCTCCTTTAAGACAAA pLKO.1 1772 CDS 100% 4.950 3.465 N Elavl2 n/a
14 TRCN0000317611 GCAGGTCTCCTTTAAGACAAA pLKO_005 1772 CDS 100% 4.950 3.465 N Elavl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030253232.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00495 pDONR223 100% 84.8% 88.6% None (many diffs) n/a
2 ccsbBroad304_00495 pLX_304 0% 84.8% 88.6% V5 (many diffs) n/a
3 TRCN0000471175 GTAAAGATAGGACGGCTTGTGCTG pLX_317 38.6% 84.8% 88.6% V5 (many diffs) n/a
Download CSV