Transcript: Mouse XM_030253640.1

PREDICTED: Mus musculus TBC1 domain family, member 2 (Tbc1d2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Tbc1d2 (381605)
Length:
5292
CDS:
2521..3921

Additional Resources:

NCBI RefSeq record:
XM_030253640.1
NBCI Gene record:
Tbc1d2 (381605)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030253640.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248872 TCAGCGAGTACGACGACTATG pLKO_005 2804 CDS 100% 10.800 15.120 N Tbc1d2 n/a
2 TRCN0000192334 CCTAAGAAACTCTGTGGGTAT pLKO.1 224 5UTR 100% 4.050 5.670 N Tbc1d2 n/a
3 TRCN0000248868 AGACTCCCAGCCGGGTTATTA pLKO_005 435 5UTR 100% 15.000 10.500 N Tbc1d2 n/a
4 TRCN0000437191 AGACTCCCAGCCGGGTTATTA pLKO_005 435 5UTR 100% 15.000 10.500 N TBC1D2 n/a
5 TRCN0000248870 AGCATCTGGGCACTGAAATAC pLKO_005 732 5UTR 100% 13.200 9.240 N Tbc1d2 n/a
6 TRCN0000248869 CAGGCCTTGGTCACCATTATG pLKO_005 4361 3UTR 100% 13.200 9.240 N Tbc1d2 n/a
7 TRCN0000192113 CCTTCAGAACATCTCCCTAAA pLKO.1 712 5UTR 100% 10.800 7.560 N Tbc1d2 n/a
8 TRCN0000248871 GTGGGTATTTAAGTAAGTTTG pLKO_005 237 5UTR 100% 10.800 7.560 N Tbc1d2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030253640.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12212 pDONR223 100% 84.1% 86.1% None (many diffs) n/a
2 ccsbBroad304_12212 pLX_304 0% 84.1% 86.1% V5 (many diffs) n/a
3 TRCN0000474709 GAATAAACCAGACAGCCCTTCGGC pLX_317 41.2% 84.1% 86.1% V5 (many diffs) n/a
Download CSV