Transcript: Mouse XM_030254584.1

PREDICTED: Mus musculus phosphatidylserine decarboxylase (Pisd), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Pisd (320951)
Length:
2766
CDS:
711..1838

Additional Resources:

NCBI RefSeq record:
XM_030254584.1
NBCI Gene record:
Pisd (320951)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030254584.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436785 CCGTATCCACTTTGACCGAGA pLKO_005 1595 CDS 100% 2.160 1.512 N Pisd n/a
2 TRCN0000115411 CCAGTGTCTTCTGAGGACAAT pLKO.1 2327 3UTR 100% 4.950 2.970 N Pisd n/a
3 TRCN0000115412 TCCTACAATGACCTGAGCTTT pLKO.1 1650 CDS 100% 4.950 2.970 N Pisd n/a
4 TRCN0000115421 CGATGGATCAAAGAGCTCTTT pLKO.1 1485 CDS 100% 4.950 2.475 Y Pisd-ps1 n/a
5 TRCN0000115425 CGCCTCAACCAAGTAGAACTT pLKO.1 981 CDS 100% 4.950 2.475 Y Pisd-ps1 n/a
6 TRCN0000078465 CAAGGGCTCCTACAATGACTT pLKO.1 1643 CDS 100% 4.950 3.465 N PISD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030254584.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02840 pDONR223 100% 86.2% 90.1% None (many diffs) n/a
2 ccsbBroad304_02840 pLX_304 0% 86.2% 90.1% V5 (many diffs) n/a
3 TRCN0000470351 TCTTGCATCGTGTGAACGACTCAT pLX_317 44.3% 86.2% 90.1% V5 (many diffs) n/a
Download CSV