Transcript: Mouse XM_030255666.1

PREDICTED: Mus musculus kelch domain containing 10 (Klhdc10), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Klhdc10 (76788)
Length:
6038
CDS:
695..1555

Additional Resources:

NCBI RefSeq record:
XM_030255666.1
NBCI Gene record:
Klhdc10 (76788)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030255666.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201315 GAACTCATCGAGCGTTTGAAA pLKO.1 1532 CDS 100% 5.625 7.875 N Klhdc10 n/a
2 TRCN0000189880 CGGCTACATCTATAGCACAGA pLKO.1 904 CDS 100% 2.640 2.112 N Klhdc10 n/a
3 TRCN0000346813 CGGCTACATCTATAGCACAGA pLKO_005 904 CDS 100% 2.640 2.112 N Klhdc10 n/a
4 TRCN0000346757 CTATGTGTTTGGAGGGTATAA pLKO_005 693 5UTR 100% 13.200 9.240 N Klhdc10 n/a
5 TRCN0000191794 GCATACAACCTTGAAACAAAT pLKO.1 1097 CDS 100% 13.200 9.240 N Klhdc10 n/a
6 TRCN0000346814 GCATACAACCTTGAAACAAAT pLKO_005 1097 CDS 100% 13.200 9.240 N Klhdc10 n/a
7 TRCN0000363963 GGAGCTTTGGCGGTATCATTT pLKO_005 768 CDS 100% 13.200 9.240 N Klhdc10 n/a
8 TRCN0000192253 CCTCTGTTGTTGTCTCTCAAA pLKO.1 2228 3UTR 100% 4.950 3.465 N Klhdc10 n/a
9 TRCN0000191162 CGTCCATAAGTTTGTGAGATT pLKO.1 5386 3UTR 100% 4.950 3.465 N Klhdc10 n/a
10 TRCN0000215407 GTCACAGTTGTGTTCAAATTA pLKO.1 1179 CDS 100% 15.000 9.000 N Klhdc10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030255666.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07826 pDONR223 100% 59.2% 54.3% None (many diffs) n/a
2 ccsbBroad304_07826 pLX_304 0% 59.2% 54.3% V5 (many diffs) n/a
3 TRCN0000481569 TATTTCAATAACAGGATGTTAGGC pLX_317 32.8% 59.2% 54.3% V5 (many diffs) n/a
Download CSV