Transcript: Human XR_001736935.1

PREDICTED: Homo sapiens adenosylhomocysteinase like 1 (AHCYL1), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AHCYL1 (10768)
Length:
4289
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001736935.1
NBCI Gene record:
AHCYL1 (10768)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001736935.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051453 GCACTGATAGAACTCTATAAT pLKO.1 2027 3UTR 100% 15.000 21.000 N AHCYL1 n/a
2 TRCN0000299611 GCACTGATAGAACTCTATAAT pLKO_005 2027 3UTR 100% 15.000 21.000 N AHCYL1 n/a
3 TRCN0000051454 CGGCAAGTCGATGTCGTAATA pLKO.1 1551 3UTR 100% 13.200 18.480 N AHCYL1 n/a
4 TRCN0000299610 CGGCAAGTCGATGTCGTAATA pLKO_005 1551 3UTR 100% 13.200 18.480 N AHCYL1 n/a
5 TRCN0000303728 CAATGTCTAAATCGCCTTAAA pLKO_005 2576 3UTR 100% 13.200 10.560 N AHCYL1 n/a
6 TRCN0000314193 GAAGTATCCAAACGTGTTTAA pLKO_005 1175 3UTR 100% 13.200 9.240 N Ahcyl1 n/a
7 TRCN0000051457 GATGTGATGTTTGGTGGGAAA pLKO.1 1374 3UTR 100% 4.050 2.835 N AHCYL1 n/a
8 TRCN0000310439 GATGTGATGTTTGGTGGGAAA pLKO_005 1374 3UTR 100% 4.050 2.835 N AHCYL1 n/a
9 TRCN0000051455 CCATCATTTGATGCCCACCTT pLKO.1 2126 3UTR 100% 2.640 1.848 N AHCYL1 n/a
10 TRCN0000051456 CAGCAGCAATTTCTGTGTGAA pLKO.1 761 3UTR 100% 4.950 2.970 N AHCYL1 n/a
11 TRCN0000101597 GCTCTGATTTCACTCAGGAAA pLKO.1 843 3UTR 100% 4.950 2.970 N Ahcyl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001736935.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02522 pDONR223 100% 36.1% None (many diffs) n/a
2 ccsbBroad304_02522 pLX_304 0% 36.1% V5 (many diffs) n/a
3 TRCN0000479541 CTCCGAGCAGCTAGTGTGTACACC pLX_317 23.3% 36.1% V5 (many diffs) n/a
4 ccsbBroadEn_11546 pDONR223 100% 34.7% None (many diffs) n/a
5 ccsbBroad304_11546 pLX_304 0% 34.7% V5 (many diffs) n/a
6 TRCN0000478243 TCTTTAAGGATATACCGATCACAC pLX_317 17.6% 34.7% V5 (many diffs) n/a
Download CSV