Transcript: Human XR_001737136.1

PREDICTED: Homo sapiens zinc finger and BTB domain containing 48 (ZBTB48), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZBTB48 (3104)
Length:
2256
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001737136.1
NBCI Gene record:
ZBTB48 (3104)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001737136.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014722 CGACCGGGTAGAGAACTACAA pLKO.1 1921 3UTR 100% 4.950 6.930 N ZBTB48 n/a
2 TRCN0000232067 CCGAGTGTGGCTACAAGTTTA pLKO_005 1863 3UTR 100% 13.200 9.240 N ZBTB48 n/a
3 TRCN0000232066 CCTCAGCAAATATTATCTAAA pLKO_005 1025 3UTR 100% 13.200 9.240 N ZBTB48 n/a
4 TRCN0000257283 CCCAAATGTGGGAAGTGTTAC pLKO_005 1089 3UTR 100% 10.800 7.560 N ZBTB48 n/a
5 TRCN0000232064 CTGGCTTCGCTGAGATCTTTG pLKO_005 325 3UTR 100% 10.800 7.560 N ZBTB48 n/a
6 TRCN0000014719 CCAGGAGGAAGTCAAATGTAA pLKO.1 886 3UTR 100% 5.625 3.938 N ZBTB48 n/a
7 TRCN0000014721 GCAGCTGCATGAAGCTTTCAA pLKO.1 1391 3UTR 100% 5.625 3.938 N ZBTB48 n/a
8 TRCN0000014718 CCAGCAGTTCATGCAGAAGAA pLKO.1 1277 3UTR 100% 4.950 3.465 N ZBTB48 n/a
9 TRCN0000232065 CTGACCAGGAGGAAGTCAAAT pLKO_005 882 3UTR 100% 13.200 7.920 N ZBTB48 n/a
10 TRCN0000014720 GAATGTGAACAGCCACGTCAA pLKO.1 533 3UTR 100% 4.050 2.430 N ZBTB48 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001737136.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00739 pDONR223 100% 91.1% None 1_125del;1639_1640insAGCC;2186_2256del n/a
2 ccsbBroad304_00739 pLX_304 0% 91.1% V5 1_125del;1639_1640insAGCC;2186_2256del n/a
3 TRCN0000470716 TGTTAGCAAACGTAGTAAAAAGTC pLX_317 20.3% 91.1% V5 1_125del;1639_1640insAGCC;2186_2256del n/a
Download CSV