Transcript: Human XR_001737208.2

PREDICTED: Homo sapiens desumoylating isopeptidase 2 (DESI2), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DESI2 (51029)
Length:
744
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001737208.2
NBCI Gene record:
DESI2 (51029)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001737208.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419052 GAACGAATATACCTCATCCAT pLKO_005 183 3UTR 100% 3.000 2.400 N DESI2 n/a
2 TRCN0000168008 CGGACTTCCTAGAAGATGATA pLKO.1 365 3UTR 100% 5.625 3.938 N DESI2 n/a
3 TRCN0000172609 GAAAGAGATTCCTCGCTGGAT pLKO.1 668 3UTR 100% 2.640 1.848 N DESI2 n/a
4 TRCN0000216107 CTTCAGCTTTATCAGAGATTC pLKO.1 467 3UTR 100% 10.800 7.560 N Desi2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001737208.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03180 pDONR223 100% 49.4% None (many diffs) n/a
2 ccsbBroad304_03180 pLX_304 0% 49.4% V5 (many diffs) n/a
3 TRCN0000480850 TTGCAGGATTCGATTTTCGGGCAA pLX_317 65.9% 49.4% V5 (many diffs) n/a
Download CSV