Transcript: Human XR_001737492.1

PREDICTED: Homo sapiens autophagy related 4C cysteine peptidase (ATG4C), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATG4C (84938)
Length:
2558
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001737492.1
NBCI Gene record:
ATG4C (84938)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001737492.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432247 GCGAAATGAAGTTTATCATAG pLKO_005 783 3UTR 100% 10.800 8.640 N ATG4C n/a
2 TRCN0000414876 ATCCTGATTTACAAGGAATAA pLKO_005 959 3UTR 100% 13.200 9.240 N ATG4C n/a
3 TRCN0000073804 CCTGGCCTGATGCTTTGAATA pLKO.1 611 3UTR 100% 13.200 9.240 N ATG4C n/a
4 TRCN0000428748 TCATTCCAGAGACTATGATTT pLKO_005 1336 3UTR 100% 13.200 9.240 N ATG4C n/a
5 TRCN0000030948 GAAATATAGTTGGGTGTTGAA pLKO.1 279 3UTR 100% 4.950 3.465 N Atg4c n/a
6 TRCN0000073807 GCATCATTTGAAGCATCACTT pLKO.1 685 3UTR 100% 4.950 3.465 N ATG4C n/a
7 TRCN0000073806 CCTGGAATATTGTGTGGGTAT pLKO.1 1018 3UTR 100% 4.050 2.835 N ATG4C n/a
8 TRCN0000073805 GCCTGGAATATTGTGTGGGTA pLKO.1 1017 3UTR 100% 2.640 1.848 N ATG4C n/a
9 TRCN0000073803 GCTTGATAAGAAGAATTCCAT pLKO.1 1467 3UTR 100% 0.000 0.000 N ATG4C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001737492.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04451 pDONR223 100% 45.8% None 1_210del;1004_1005ins137;1448_2558del n/a
2 ccsbBroad304_04451 pLX_304 0% 45.8% V5 1_210del;1004_1005ins137;1448_2558del n/a
3 TRCN0000467723 CTCGGAATCATCGAAAGATTCCTT pLX_317 27.7% 45.8% V5 1_210del;1004_1005ins137;1448_2558del n/a
Download CSV