Transcript: Human XR_001737496.2

PREDICTED: Homo sapiens PTPRF interacting protein alpha 4 (PPFIA4), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPFIA4 (8497)
Length:
6401
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001737496.2
NBCI Gene record:
PPFIA4 (8497)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001737496.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052695 CGGGAGGAAGAGATATCAGAA pLKO.1 797 3UTR 100% 4.950 3.960 N PPFIA4 n/a
2 TRCN0000376282 TGTCTGAAGAGGCTGAATTAT pLKO_005 3507 3UTR 100% 15.000 10.500 N Ppfia4 n/a
3 TRCN0000052696 CCTGTCTGAAGAGATTGAGAA pLKO.1 1933 3UTR 100% 4.950 3.465 N PPFIA4 n/a
4 TRCN0000052694 GCATGAGATCAAGGATGTGTT pLKO.1 3566 3UTR 100% 4.950 3.465 N PPFIA4 n/a
5 TRCN0000052693 CCAAAGAAGATCATGCCTGAA pLKO.1 3984 3UTR 100% 4.050 2.835 N PPFIA4 n/a
6 TRCN0000174247 CCAAAGAAGATCATGCCTGAA pLKO.1 3984 3UTR 100% 4.050 2.835 N PPFIA4 n/a
7 TRCN0000052697 CCCAGTGACTTAAGAAAGCAT pLKO.1 2579 3UTR 100% 3.000 2.100 N PPFIA4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001737496.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07247 pDONR223 100% 31.2% None (many diffs) n/a
2 ccsbBroad304_07247 pLX_304 0% 31.2% V5 (many diffs) n/a
3 TRCN0000480685 TCGATCTTAAGAGGCCGGTGGTAA pLX_317 15.8% 31.2% V5 (many diffs) n/a
Download CSV