Transcript: Human XR_001737550.2

PREDICTED: Homo sapiens chromodomain helicase DNA binding protein 1 like (CHD1L), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CHD1L (9557)
Length:
2839
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001737550.2
NBCI Gene record:
CHD1L (9557)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001737550.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013469 GCAGGAAGATTAAATGATGAA pLKO.1 323 3UTR 100% 4.950 6.930 N CHD1L n/a
2 TRCN0000297836 GCAGGAAGATTAAATGATGAA pLKO_005 323 3UTR 100% 4.950 6.930 N CHD1L n/a
3 TRCN0000013472 CGTATTGGACATGCCACGAAA pLKO.1 2416 3UTR 100% 4.950 3.465 N CHD1L n/a
4 TRCN0000280395 CGTATTGGACATGCCACGAAA pLKO_005 2416 3UTR 100% 4.950 3.465 N CHD1L n/a
5 TRCN0000013471 GCCAAGAGAAGGAGACTCATA pLKO.1 1846 3UTR 100% 4.950 3.465 N CHD1L n/a
6 TRCN0000280441 GCCAAGAGAAGGAGACTCATA pLKO_005 1846 3UTR 100% 4.950 3.465 N CHD1L n/a
7 TRCN0000013468 CCTGTCTTTAGCAACCAGCTA pLKO.1 2607 3UTR 100% 2.640 1.848 N CHD1L n/a
8 TRCN0000297839 CCTGTCTTTAGCAACCAGCTA pLKO_005 2607 3UTR 100% 2.640 1.848 N CHD1L n/a
9 TRCN0000013470 GCACAAACTCTTGCAGCCATT pLKO.1 808 3UTR 100% 4.050 2.430 N CHD1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001737550.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11389 pDONR223 100% 63.6% None (many diffs) n/a
2 ccsbBroad304_11389 pLX_304 0% 63.6% V5 (many diffs) n/a
3 TRCN0000479276 GCTGATGTGCAGGCAAGTTCTTGA pLX_317 18% 63.6% V5 (many diffs) n/a
Download CSV