Transcript: Human XR_001738668.2

PREDICTED: Homo sapiens fibroblast activation protein alpha (FAP), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAP (2191)
Length:
1715
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001738668.2
NBCI Gene record:
FAP (2191)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001738668.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355738 ATCCCGTTGTTCGGATATTTA pLKO_005 921 3UTR 100% 15.000 21.000 N FAP n/a
2 TRCN0000355736 GATACGGATATACCAGTTATT pLKO_005 827 3UTR 100% 13.200 18.480 N FAP n/a
3 TRCN0000006805 GCATTGTCTTACGCCCTTCAA pLKO.1 213 3UTR 100% 4.950 6.930 N FAP n/a
4 TRCN0000006806 GCGATGAACAATATCCTAGAA pLKO.1 864 3UTR 100% 4.950 6.930 N FAP n/a
5 TRCN0000006803 CGGAATTTAATGATACGGATA pLKO.1 816 3UTR 100% 4.050 3.240 N FAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001738668.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491844 GTTATGGCCCGAAGTTCCCCCTTC pLX_317 9.2% 56.9% V5 (not translated due to prior stop codon) 1_145del;1548_1667del;1715_1716ins830 n/a
2 TRCN0000489227 CAGGGGTGGAGGGGATATCAACAT pLX_317 16.7% 56.9% V5 1_145del;1548_1667del;1715_1716ins831 n/a
Download CSV