Transcript: Human XR_001738942.1

PREDICTED: Homo sapiens polypeptide N-acetylgalactosaminyltransferase 14 (GALNT14), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GALNT14 (79623)
Length:
1998
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001738942.1
NBCI Gene record:
GALNT14 (79623)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001738942.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035218 CGGGAAATCATATTAGTGGAT pLKO.1 537 3UTR 100% 2.640 3.696 N GALNT14 n/a
2 TRCN0000423406 GGTGAAATGCTTGCGCAATAA pLKO_005 608 3UTR 100% 13.200 9.240 N GALNT14 n/a
3 TRCN0000420845 GTGTGCCCTGTGATCGATATC pLKO_005 777 3UTR 100% 10.800 7.560 N GALNT14 n/a
4 TRCN0000035215 CCTGTCAGTCATCACCTTGTT pLKO.1 1535 3UTR 100% 4.950 3.465 N GALNT14 n/a
5 TRCN0000093696 CGGCGGTATCTGAATGCCAAA pLKO.1 282 3UTR 100% 4.050 2.835 N Galnt14 n/a
6 TRCN0000035217 CTGGAGAATATCTACCCTGAA pLKO.1 1317 3UTR 100% 4.050 2.835 N GALNT14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001738942.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08938 pDONR223 100% 77.5% None (many diffs) n/a
2 ccsbBroad304_08938 pLX_304 0% 77.5% V5 (many diffs) n/a
3 TRCN0000477968 TTGTCACCTATGATACTTTATTAA pLX_317 11.3% 77.5% V5 (many diffs) n/a
Download CSV