Transcript: Human XR_001739074.1

PREDICTED: Homo sapiens calpain 13 (CAPN13), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CAPN13 (92291)
Length:
4085
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001739074.1
NBCI Gene record:
CAPN13 (92291)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001739074.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073784 CCATGTTTATATGTAGCGAAA pLKO.1 1425 3UTR 100% 4.050 5.670 N CAPN13 n/a
2 TRCN0000073785 GCCATGTTTATATGTAGCGAA pLKO.1 1424 3UTR 100% 2.640 3.696 N CAPN13 n/a
3 TRCN0000073786 CCACTCGATTTCCAAGTGATT pLKO.1 1661 3UTR 100% 4.950 3.960 N CAPN13 n/a
4 TRCN0000421733 ACGAAGGATGGTCCCAAATAA pLKO_005 1479 3UTR 100% 15.000 10.500 N CAPN13 n/a
5 TRCN0000433154 CACTGTCCAAAGCTCAAATAA pLKO_005 1744 3UTR 100% 15.000 10.500 N CAPN13 n/a
6 TRCN0000421330 TGCTGTCACACCATCAAATTT pLKO_005 1618 3UTR 100% 15.000 10.500 N CAPN13 n/a
7 TRCN0000073783 CCCAGTATGGTGGTTGTGATA pLKO.1 3676 3UTR 100% 4.950 3.465 N CAPN13 n/a
8 TRCN0000073787 CCTGGATGATATAAGCAGATT pLKO.1 676 3UTR 100% 4.950 3.465 N CAPN13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001739074.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09333 pDONR223 100% 49.1% None (many diffs) n/a
2 ccsbBroad304_09333 pLX_304 0% 49.1% V5 (many diffs) n/a
3 TRCN0000476548 ACCATACCTTTACGAAACTGCAGC pLX_317 20.6% 49.1% V5 (many diffs) n/a
4 ccsbBroadEn_09334 pDONR223 100% 49% None (many diffs) n/a
5 ccsbBroad304_09334 pLX_304 0% 49% V5 (many diffs) n/a
6 TRCN0000481237 TTAACGTTGGTGCGGTGCTATATA pLX_317 19.7% 49% V5 (many diffs) n/a
Download CSV