Transcript: Human XR_001739992.2

PREDICTED: Homo sapiens oxysterol binding protein like 11 (OSBPL11), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OSBPL11 (114885)
Length:
3725
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001739992.2
NBCI Gene record:
OSBPL11 (114885)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001739992.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105197 GCAACTATGAACTGCTTAAAT pLKO.1 1110 3UTR 100% 15.000 10.500 N Osbpl11 n/a
2 TRCN0000325814 GCAACTATGAACTGCTTAAAT pLKO_005 1110 3UTR 100% 15.000 10.500 N Osbpl11 n/a
3 TRCN0000158527 CACTTGCATCTAGTAGTAATT pLKO.1 844 3UTR 100% 13.200 9.240 N OSBPL11 n/a
4 TRCN0000161455 CGAGTGGTTAGAACCAAAGAT pLKO.1 1202 3UTR 100% 5.625 3.938 N OSBPL11 n/a
5 TRCN0000160386 CAGGATCTCTTAATGCTCAAA pLKO.1 1077 3UTR 100% 4.950 3.465 N OSBPL11 n/a
6 TRCN0000160605 CTGTTGGAGTACTTTGTGAAT pLKO.1 585 3UTR 100% 4.950 3.465 N OSBPL11 n/a
7 TRCN0000158810 CTTGAGTTCACATATAGCAAT pLKO.1 1739 3UTR 100% 4.950 3.465 N OSBPL11 n/a
8 TRCN0000161317 GCTGTAATATCACCCAGTGAT pLKO.1 654 3UTR 100% 4.950 3.465 N OSBPL11 n/a
9 TRCN0000161454 CCAGGATCTCTTAATGCTCAA pLKO.1 1076 3UTR 100% 4.050 2.835 N OSBPL11 n/a
10 TRCN0000343356 CCAGGATCTCTTAATGCTCAA pLKO_005 1076 3UTR 100% 4.050 2.835 N OSBPL11 n/a
11 TRCN0000160239 CCTACTTATTATGGTGCTCAA pLKO.1 3319 3UTR 100% 4.050 2.430 N OSBPL11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001739992.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13042 pDONR223 100% 25.8% None (many diffs) n/a
2 ccsbBroad304_13042 pLX_304 0% 25.8% V5 (many diffs) n/a
3 TRCN0000480767 GCTGGCAATCCTATTCCCTAGAAC pLX_317 47.9% 25.8% V5 (many diffs) n/a
Download CSV