Transcript: Human XR_001740086.1

PREDICTED: Homo sapiens armadillo repeat containing 8 (ARMC8), transcript variant X15, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARMC8 (25852)
Length:
4995
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001740086.1
NBCI Gene record:
ARMC8 (25852)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001740086.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166876 CGGACAGATGATAACTGTATT pLKO.1 1110 3UTR 100% 13.200 9.240 N ARMC8 n/a
2 TRCN0000319086 CGGACAGATGATAACTGTATT pLKO_005 1110 3UTR 100% 13.200 9.240 N ARMC8 n/a
3 TRCN0000167599 GAGAATTGTTACCACAGATTT pLKO.1 1000 3UTR 100% 13.200 9.240 N ARMC8 n/a
4 TRCN0000319013 GAGAATTGTTACCACAGATTT pLKO_005 1000 3UTR 100% 13.200 9.240 N ARMC8 n/a
5 TRCN0000168419 GTGAAGATGTTACAGAGGGAT pLKO.1 1023 3UTR 100% 2.640 1.848 N ARMC8 n/a
6 TRCN0000319014 GTGAAGATGTTACAGAGGGAT pLKO_005 1023 3UTR 100% 2.640 1.848 N ARMC8 n/a
7 TRCN0000167668 GCACTGAAATGTTTCTCAGTT pLKO.1 924 3UTR 100% 0.495 0.347 N ARMC8 n/a
8 TRCN0000319084 GCACTGAAATGTTTCTCAGTT pLKO_005 924 3UTR 100% 0.495 0.347 N ARMC8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001740086.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02872 pDONR223 100% 22.8% None (many diffs) n/a
2 ccsbBroad304_02872 pLX_304 0% 22.8% V5 (many diffs) n/a
3 TRCN0000474364 GCAATCAGATGATACCTCGAAGCC pLX_317 45.2% 22.8% V5 (many diffs) n/a
Download CSV