Transcript: Human XR_001741334.2

PREDICTED: Homo sapiens abraxas 1, BRCA1 A complex subunit (ABRAXAS1), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABRAXAS1 (84142)
Length:
944
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001741334.2
NBCI Gene record:
ABRAXAS1 (84142)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001741334.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426063 ATCCTTAAAGGAGGTACATAA pLKO_005 686 3UTR 100% 13.200 10.560 N ABRAXAS1 n/a
2 TRCN0000143855 CATCGACTGGAACATTCCTTA pLKO.1 504 3UTR 100% 4.950 3.465 N ABRAXAS1 n/a
3 TRCN0000122344 CAGTACAAACACACAGCTCTA pLKO.1 646 3UTR 100% 4.050 2.835 N ABRAXAS1 n/a
4 TRCN0000139964 GCATGTCTGAACAACTGGGTT pLKO.1 580 3UTR 100% 2.640 1.848 N ABRAXAS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001741334.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12784 pDONR223 100% 29.1% None 1_392del;743_878del;944_945ins484 n/a
2 ccsbBroad304_12784 pLX_304 0% 29.1% V5 1_392del;743_878del;944_945ins484 n/a
3 TRCN0000478871 ATGGCTGCTTTCCGGAGTGTTTTA pLX_317 39.7% 29.1% V5 1_392del;743_878del;944_945ins484 n/a
Download CSV