Transcript: Human XR_001742014.2

PREDICTED: Homo sapiens transmembrane protein 161B (TMEM161B), transcript variant X19, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM161B (153396)
Length:
3755
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001742014.2
NBCI Gene record:
TMEM161B (153396)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001742014.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428122 GGCTATCTACAAGGGTAATAT pLKO_005 1787 3UTR 100% 15.000 21.000 N TMEM161B n/a
2 TRCN0000431162 ATAATAGTCTACTGTCCAATT pLKO_005 1307 3UTR 100% 10.800 15.120 N TMEM161B n/a
3 TRCN0000430664 GCATATCCAAATCACCCTTTA pLKO_005 1552 3UTR 100% 10.800 15.120 N TMEM161B n/a
4 TRCN0000167747 GCAGAAGATTATACCTCACTA pLKO.1 160 3UTR 100% 4.950 3.960 N TMEM161B n/a
5 TRCN0000168156 CTCTGCGACTCTGGTTAATAA pLKO.1 1104 3UTR 100% 15.000 10.500 N TMEM161B n/a
6 TRCN0000167867 GCAAAGAAAGTATCCCTTTAA pLKO.1 1062 3UTR 100% 13.200 9.240 N TMEM161B n/a
7 TRCN0000416113 TGGTACTGTTGATAGTCATAG pLKO_005 1895 3UTR 100% 10.800 7.560 N TMEM161B n/a
8 TRCN0000172896 GCCAGTGTCATGCAGAAGATT pLKO.1 149 3UTR 100% 5.625 3.938 N TMEM161B n/a
9 TRCN0000167653 GCTTGAGAATAGCAAGAGTAT pLKO.1 2128 3UTR 100% 4.950 3.465 N TMEM161B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001742014.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09696 pDONR223 100% 35.3% None (many diffs) n/a
2 ccsbBroad304_09696 pLX_304 0% 35.3% V5 (many diffs) n/a
3 TRCN0000469018 TAAAGTCATGTCAAGCCTTTAGAC pLX_317 27.9% 35.3% V5 (many diffs) n/a
Download CSV