Transcript: Human XR_001742141.1

PREDICTED: Homo sapiens WD repeat domain 41 (WDR41), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WDR41 (55255)
Length:
4304
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001742141.1
NBCI Gene record:
WDR41 (55255)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001742141.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147209 CCGCTGATCATCTCATTATTT pLKO.1 1577 3UTR 100% 15.000 21.000 N WDR41 n/a
2 TRCN0000369219 CTTGATCACCAGGATAATATT pLKO_005 942 3UTR 100% 15.000 21.000 N WDR41 n/a
3 TRCN0000369220 ATACGTGTATAGCCTTCAAAT pLKO_005 1199 3UTR 100% 13.200 18.480 N WDR41 n/a
4 TRCN0000376411 GAATCTGGATTGCGCAGTTTA pLKO_005 1618 3UTR 100% 13.200 18.480 N WDR41 n/a
5 TRCN0000149821 CCACCTTTCTGATACAGGTAT pLKO.1 794 3UTR 100% 4.950 6.930 N WDR41 n/a
6 TRCN0000148509 CCTAGATCCTTGTGAAAGGTA pLKO.1 1962 3UTR 100% 3.000 4.200 N WDR41 n/a
7 TRCN0000364521 TATACCTTGCTGTCTAGTTTA pLKO_005 1673 3UTR 100% 13.200 10.560 N WDR41 n/a
8 TRCN0000364522 CATGTTCACTGGAGCTTATTG pLKO_005 1484 3UTR 100% 13.200 9.240 N WDR41 n/a
9 TRCN0000369218 TGCTTCTCAGGTCCTAGTATA pLKO_005 1854 3UTR 100% 13.200 9.240 N WDR41 n/a
10 TRCN0000183411 CCAAAGAATATACCACAAGTT pLKO.1 1879 3UTR 100% 4.950 3.465 N WDR41 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001742141.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03564 pDONR223 100% 31.9% None 1_287del;1379_1400del;1687_4304del n/a
2 ccsbBroad304_03564 pLX_304 0% 31.9% V5 1_287del;1379_1400del;1687_4304del n/a
3 TRCN0000491687 AATACCTCGCAAGCCACCGTGAGT pLX_317 25.6% 31.9% V5 1_287del;1379_1400del;1687_4304del n/a
4 ccsbBroadEn_15893 pDONR223 0% 23.3% None (many diffs) n/a
5 ccsbBroad304_15893 pLX_304 0% 23.3% V5 (many diffs) n/a
Download CSV