Transcript: Human XR_001742373.1

PREDICTED: Homo sapiens zinc finger FYVE-type containing 16 (ZFYVE16), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZFYVE16 (9765)
Length:
6398
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001742373.1
NBCI Gene record:
ZFYVE16 (9765)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001742373.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057053 GCGAACTTCATTGCTCCCAAA pLKO.1 333 3UTR 100% 4.050 5.670 N ZFYVE16 n/a
2 TRCN0000369972 GATGAAATCCAGCCGTTATAT pLKO_005 514 3UTR 100% 15.000 12.000 N ZFYVE16 n/a
3 TRCN0000304075 ACTTGTTGACCTTCGAAATTA pLKO_005 3864 3UTR 100% 15.000 10.500 N ZFYVE16 n/a
4 TRCN0000377421 TTTGAGGTCTTAGACTTATAA pLKO_005 5094 3UTR 100% 15.000 10.500 N ZFYVE16 n/a
5 TRCN0000304076 GGTCTATGTGTGGATCATTAA pLKO_005 1325 3UTR 100% 13.200 9.240 N ZFYVE16 n/a
6 TRCN0000304013 AGTATCTGCACTTAGGTATAC pLKO_005 4932 3UTR 100% 10.800 7.560 N ZFYVE16 n/a
7 TRCN0000057057 GCCAGCCATGTGGATTACTAA pLKO.1 977 3UTR 100% 5.625 3.938 N ZFYVE16 n/a
8 TRCN0000057056 CCAGATACAATAGAAAGTGAA pLKO.1 2191 3UTR 100% 4.950 3.465 N ZFYVE16 n/a
9 TRCN0000057055 CCTGTTACATTTGTCCTAAAT pLKO.1 3352 3UTR 100% 13.200 7.920 N ZFYVE16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001742373.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14026 pDONR223 100% 56.3% None (many diffs) n/a
2 ccsbBroad304_14026 pLX_304 0% 56.3% V5 (many diffs) n/a
3 TRCN0000478205 GGAGATGCCCGTTTCCACTAATGA pLX_317 7.8% 56.3% V5 (many diffs) n/a
Download CSV