Transcript: Human XR_001743172.2

PREDICTED: Homo sapiens sterile alpha motif domain containing 3 (SAMD3), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SAMD3 (154075)
Length:
1937
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001743172.2
NBCI Gene record:
SAMD3 (154075)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001743172.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245492 ACCTTGATAATGGACTAATTG pLKO_005 499 3UTR 100% 13.200 18.480 N SAMD3 n/a
2 TRCN0000172739 GCCGCTCTTCTTGCACTTAAT pLKO.1 255 3UTR 100% 13.200 18.480 N SAMD3 n/a
3 TRCN0000167864 GAGTATTGAAACAGAGAAGAA pLKO.1 526 3UTR 100% 4.950 6.930 N SAMD3 n/a
4 TRCN0000253023 GCCCTCAAAGATCGCTTTAAA pLKO_005 828 3UTR 100% 15.000 12.000 N Samd3 n/a
5 TRCN0000245493 AGGCCGACATGACTAAGTATC pLKO_005 694 3UTR 100% 10.800 7.560 N SAMD3 n/a
6 TRCN0000245494 ATGGTTCAGCAACTGGTAAAG pLKO_005 282 3UTR 100% 10.800 7.560 N SAMD3 n/a
7 TRCN0000245490 TTTAGGAGAGCTAGTTCATAG pLKO_005 209 3UTR 100% 10.800 7.560 N SAMD3 n/a
8 TRCN0000167010 GCTGTTCTGATGGATTTAATT pLKO.1 318 3UTR 100% 15.000 9.000 N SAMD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001743172.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09706 pDONR223 100% 33.9% None (many diffs) n/a
2 ccsbBroad304_09706 pLX_304 0% 33.9% V5 (many diffs) n/a
3 TRCN0000470354 AAGCATGACCCCTATGGCTCGTTA pLX_317 78.5% 33.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV