Transcript: Human XR_001743178.1

PREDICTED: Homo sapiens ring finger protein 217 (RNF217), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF217 (154214)
Length:
1796
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001743178.1
NBCI Gene record:
RNF217 (154214)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001743178.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034124 GCTCACAATGTAACACTAATT pLKO.1 1604 3UTR 100% 13.200 18.480 N RNF217 n/a
2 TRCN0000341592 CCTTGGCATGAAGGTGTTAAC pLKO_005 1447 3UTR 100% 10.800 15.120 N Rnf217 n/a
3 TRCN0000341658 CACATCAAACCTCAGTATATT pLKO_005 1677 3UTR 100% 15.000 10.500 N Rnf217 n/a
4 TRCN0000034127 CCACACATCAAACCTCAGTAT pLKO.1 1674 3UTR 100% 4.950 3.465 N RNF217 n/a
5 TRCN0000034126 GCATGAAGACTCCATCAAGTA pLKO.1 1088 3UTR 100% 4.950 3.465 N RNF217 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001743178.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05079 pDONR223 100% 32.1% None (many diffs) n/a
2 ccsbBroad304_05079 pLX_304 0% 32.1% V5 (many diffs) n/a
3 TRCN0000476605 TACTTTCGTGGAAGTTTTCAATTG pLX_317 39.8% 32.1% V5 (many diffs) n/a
Download CSV