Transcript: Human XR_001743241.2

PREDICTED: Homo sapiens FYVE, RhoGEF and PH domain containing 2 (FGD2), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FGD2 (221472)
Length:
4282
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001743241.2
NBCI Gene record:
FGD2 (221472)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001743241.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048256 CAAATCGAGAAGCGGAATGAA pLKO.1 1418 3UTR 100% 5.625 7.875 N FGD2 n/a
2 TRCN0000048253 CGAACTGAAATACGACGACAA pLKO.1 1654 3UTR 100% 4.050 5.670 N FGD2 n/a
3 TRCN0000048254 CCTCCATCTATCAGTTCCATT pLKO.1 627 3UTR 100% 4.950 3.465 N FGD2 n/a
4 TRCN0000048257 CTGGTCACTGTGTTTGAGAAT pLKO.1 206 3UTR 100% 4.950 3.465 N FGD2 n/a
5 TRCN0000048255 GTACCTGAACTCCCTGAAGAA pLKO.1 376 3UTR 100% 0.000 0.000 N FGD2 n/a
6 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2416 3UTR 100% 13.200 6.600 Y LIAS n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4078 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4078 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001743241.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13428 pDONR223 100% 7.1% None (many diffs) n/a
2 ccsbBroad304_13428 pLX_304 0% 7.1% V5 (many diffs) n/a
3 TRCN0000475313 GCTATTTCATGCATACAGCACTTA pLX_317 98.1% 7.1% V5 (many diffs) n/a
Download CSV