Transcript: Human XR_001743350.2

PREDICTED: Homo sapiens GDP-mannose 4,6-dehydratase (GMDS), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GMDS (2762)
Length:
7812
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001743350.2
NBCI Gene record:
GMDS (2762)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001743350.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052468 GCCGGTCAGTAGCTAAGATTT pLKO.1 854 3UTR 100% 13.200 18.480 N GMDS n/a
2 TRCN0000052471 CGTGAGGCGTATAATCTCTTT pLKO.1 763 3UTR 100% 4.950 6.930 N GMDS n/a
3 TRCN0000052472 GTTCATTTAATACGGGTCGAA pLKO.1 356 3UTR 100% 2.640 3.696 N GMDS n/a
4 TRCN0000423786 AGCCTCAACAAGTGAACTTTA pLKO_005 639 3UTR 100% 13.200 9.240 N GMDS n/a
5 TRCN0000416805 CCCAGAAGAGGAGCTAATTTC pLKO_005 817 3UTR 100% 13.200 7.920 N GMDS n/a
6 TRCN0000052469 CCTGCCTTGTGAAGATCATTA pLKO.1 455 3UTR 100% 13.200 7.920 N GMDS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001743350.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06288 pDONR223 100% 12.4% None (many diffs) n/a
2 ccsbBroad304_06288 pLX_304 0% 12.4% V5 (many diffs) n/a
3 TRCN0000468310 TTGCGCCTTAATCATCCCAAACTA pLX_317 37.9% 12.4% V5 (many diffs) n/a
Download CSV