Transcript: Human XR_001743549.2

PREDICTED: Homo sapiens branched chain keto acid dehydrogenase E1 subunit beta (BCKDHB), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BCKDHB (594)
Length:
7742
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001743549.2
NBCI Gene record:
BCKDHB (594)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001743549.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236122 GCTACTGCCATTGCGGAAATT pLKO_005 451 3UTR 100% 13.200 18.480 N BCKDHB n/a
2 TRCN0000236119 CATTGATCTGAGGACTATAAT pLKO_005 933 3UTR 100% 15.000 12.000 N BCKDHB n/a
3 TRCN0000028438 CCTTGGGATGTGGACACAATT pLKO.1 955 3UTR 100% 13.200 9.240 N BCKDHB n/a
4 TRCN0000028459 CGGAAATTCAGTTTGCAGATT pLKO.1 464 3UTR 100% 4.950 3.465 N BCKDHB n/a
5 TRCN0000028471 CCAGTCTGTAACAAGTGCCTT pLKO.1 252 3UTR 100% 2.640 1.584 N BCKDHB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001743549.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00154 pDONR223 100% 14.6% None (many diffs) n/a
2 ccsbBroad304_00154 pLX_304 0% 14.6% V5 (many diffs) n/a
3 TRCN0000470199 GCAAAAATGCCGAGCGGATATGCC pLX_317 29.5% 14.6% V5 (many diffs) n/a
Download CSV