Transcript: Human XR_001743601.2

PREDICTED: Homo sapiens TPD52 like 1 (TPD52L1), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TPD52L1 (7164)
Length:
3068
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001743601.2
NBCI Gene record:
TPD52L1 (7164)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001743601.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338568 AGGTACACAACTGGTCATAAT pLKO_005 2778 3UTR 100% 13.200 18.480 N TPD52L1 n/a
2 TRCN0000338638 TAGGCGGTACGAACCCTAATG pLKO_005 2411 3UTR 100% 10.800 15.120 N TPD52L1 n/a
3 TRCN0000155521 GCAGAGTTAGTTCAGCTAGAA pLKO.1 343 3UTR 100% 4.950 3.960 N TPD52L1 n/a
4 TRCN0000338635 GCAGAGTTAGTTCAGCTAGAA pLKO_005 343 3UTR 100% 4.950 3.960 N TPD52L1 n/a
5 TRCN0000156453 CTCGGCATGAACCTGATGAAT pLKO.1 433 3UTR 100% 5.625 3.938 N TPD52L1 n/a
6 TRCN0000150777 GCATGAACCTGATGAATGAAT pLKO.1 437 3UTR 100% 5.625 3.938 N TPD52L1 n/a
7 TRCN0000338567 GCATGAACCTGATGAATGAAT pLKO_005 437 3UTR 100% 5.625 3.938 N TPD52L1 n/a
8 TRCN0000158076 CTTCTCTAGCATGCTCTCTGA pLKO.1 300 3UTR 100% 2.640 1.848 N TPD52L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001743601.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01698 pDONR223 100% 13.7% None (many diffs) n/a
2 ccsbBroad304_01698 pLX_304 0% 13.7% V5 (many diffs) n/a
3 TRCN0000468399 GATCTATAGATACCTGTTGATCTT pLX_317 76.9% 13.7% V5 (many diffs) n/a
Download CSV