Transcript: Human XR_001743668.2

PREDICTED: Homo sapiens radial spoke head 3 (RSPH3), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RSPH3 (83861)
Length:
2314
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001743668.2
NBCI Gene record:
RSPH3 (83861)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001743668.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000141665 CTCAGGGATAGTGGCTACTTT pLKO.1 1696 3UTR 100% 5.625 7.875 N RSPH3 n/a
2 TRCN0000144756 GCTGATCGCATAATAGAAGTT pLKO.1 1243 3UTR 100% 4.950 6.930 N RSPH3 n/a
3 TRCN0000121767 CCTATGCATTATGGAAACATA pLKO.1 1003 3UTR 100% 5.625 3.938 N RSPH3 n/a
4 TRCN0000143442 GAACTCTTAGGGCAAGATGAA pLKO.1 2068 3UTR 100% 4.950 3.465 N RSPH3 n/a
5 TRCN0000144835 GCTCTTTGACTTTGATCTTGA pLKO.1 1368 3UTR 100% 4.950 3.465 N RSPH3 n/a
6 TRCN0000122283 CGTGCTGAAGTTCAACGACTT pLKO.1 1519 3UTR 100% 4.050 2.835 N RSPH3 n/a
7 TRCN0000145136 GAGTATGAAGAACTACGGAAT pLKO.1 1492 3UTR 100% 4.050 2.835 N RSPH3 n/a
8 TRCN0000122888 GCTGAAGTTCAACGACTTGAA pLKO.1 1522 3UTR 100% 0.495 0.347 N RSPH3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001743668.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489257 TGCATTGCTGATGCGCGACCTAAA pLX_317 21.4% 72.6% V5 1_450del;2131_2314delinsG n/a
2 ccsbBroadEn_04300 pDONR223 100% 72.6% None 1_450del;2131_2314del n/a
3 ccsbBroad304_04300 pLX_304 0% 72.6% V5 1_450del;2131_2314del n/a
4 TRCN0000478252 GCTGCGATGTTCCCGTAGCAGGTG pLX_317 21.4% 72.6% V5 1_450del;2131_2314del n/a
5 TRCN0000492310 ATGCGCAGGGATAAGCAAAATGTG pLX_317 21.5% 72.6% V5 (not translated due to prior stop codon) 1_450del;2131_2314del n/a
Download CSV