Transcript: Human XR_001744620.1

PREDICTED: Homo sapiens oxysterol binding protein like 3 (OSBPL3), transcript variant X13, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OSBPL3 (26031)
Length:
7080
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001744620.1
NBCI Gene record:
OSBPL3 (26031)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001744620.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275975 GCCAAGAGCCAAACCGATATA pLKO_005 732 3UTR 100% 13.200 18.480 N OSBPL3 n/a
2 TRCN0000285469 TGCGTAAGCTACCCAAGTTTA pLKO_005 3857 3UTR 100% 13.200 18.480 N OSBPL3 n/a
3 TRCN0000157183 GCCTTTGCCATATCAGCGTAT pLKO.1 2532 3UTR 100% 4.050 5.670 N OSBPL3 n/a
4 TRCN0000276022 GCCTTTGCCATATCAGCGTAT pLKO_005 2532 3UTR 100% 4.050 5.670 N OSBPL3 n/a
5 TRCN0000155275 GCTGGAAGCAAGCCATTTAAT pLKO.1 2571 3UTR 100% 15.000 10.500 N OSBPL3 n/a
6 TRCN0000281980 GCTGGAAGCAAGCCATTTAAT pLKO_005 2571 3UTR 100% 15.000 10.500 N OSBPL3 n/a
7 TRCN0000151606 GAAGCGTAGCAGTATATCAAA pLKO.1 1028 3UTR 100% 5.625 3.938 N OSBPL3 n/a
8 TRCN0000276032 GAAGCGTAGCAGTATATCAAA pLKO_005 1028 3UTR 100% 5.625 3.938 N OSBPL3 n/a
9 TRCN0000158226 CGTGGCATCATTTGGGAAGAA pLKO.1 5766 3UTR 100% 4.950 3.465 N OSBPL3 n/a
10 TRCN0000152169 CAAAGTCTTTATTGCCACCTA pLKO.1 3169 3UTR 100% 2.640 1.848 N OSBPL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001744620.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000479773 TTGCCTTGAAAGTTTAACACCAAT pLX_317 13.2% 35.5% V5 (many diffs) n/a
2 ccsbBroadEn_14104 pDONR223 100% 35.4% None (many diffs) n/a
3 ccsbBroad304_14104 pLX_304 0% 35.4% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV