Transcript: Human XR_001744828.1

PREDICTED: Homo sapiens WD repeat domain 60 (WDR60), transcript variant X16, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WDR60 (55112)
Length:
3623
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001744828.1
NBCI Gene record:
WDR60 (55112)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001744828.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134998 CGCAGGTTCAATAAGTGATTT pLKO.1 2472 3UTR 100% 13.200 9.240 N WDR60 n/a
2 TRCN0000138078 GCACAGACATGGGTCTCATAA pLKO.1 2645 3UTR 100% 13.200 9.240 N WDR60 n/a
3 TRCN0000138027 GCCATGGCACAAGACAAGATT pLKO.1 2666 3UTR 100% 5.625 3.938 N WDR60 n/a
4 TRCN0000136934 CGACACATCCAACATCTACAT pLKO.1 2931 3UTR 100% 4.950 3.465 N WDR60 n/a
5 TRCN0000191802 GAGAAAGAAGATACCGAGAAA pLKO.1 721 3UTR 100% 4.950 3.465 N Wdr60 n/a
6 TRCN0000138760 GCGTTTCTGTAATGACCCAGA pLKO.1 3231 3UTR 100% 2.160 1.512 N WDR60 n/a
7 TRCN0000134759 GCATATGTTCAGTGTAACGAA pLKO.1 1773 3UTR 100% 0.000 0.000 N WDR60 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001744828.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08472 pDONR223 100% 79.6% None (many diffs) n/a
2 ccsbBroad304_08472 pLX_304 0% 79.6% V5 (many diffs) n/a
3 TRCN0000470585 ACATAACCACTAGCGAACTACTCG pLX_317 13.4% 79.6% V5 (many diffs) n/a
Download CSV