Transcript: Human XR_001746230.1

PREDICTED: Homo sapiens ankyrin repeat and sterile alpha motif domain containing 6 (ANKS6), transcript variant X11, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANKS6 (203286)
Length:
2783
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001746230.1
NBCI Gene record:
ANKS6 (203286)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001746230.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000446394 TCACGTCGACGGCATTCATTG pLKO_005 1854 3UTR 100% 10.800 15.120 N ANKS6 n/a
2 TRCN0000122619 GCGATTTCTGAACTGAACGCA pLKO.1 1590 3UTR 100% 0.750 1.050 N ANKS6 n/a
3 TRCN0000143107 GATGAACTGACTGGAATCCTT pLKO.1 1431 3UTR 100% 3.000 2.400 N ANKS6 n/a
4 TRCN0000420415 GTACTTCTTGCTGCAACAAAC pLKO_005 1878 3UTR 100% 10.800 7.560 N ANKS6 n/a
5 TRCN0000121799 CTGACTGGAATCCTTAAGAAA pLKO.1 1437 3UTR 100% 5.625 3.938 N ANKS6 n/a
6 TRCN0000144123 CCATTCACAACTTTCACTCTT pLKO.1 1645 3UTR 100% 4.950 3.465 N ANKS6 n/a
7 TRCN0000438258 CTCTTGGCCACTGGTAGTCAT pLKO_005 2132 3UTR 100% 4.950 3.465 N ANKS6 n/a
8 TRCN0000143590 GAGCTGGGAATTAAGACAGAT pLKO.1 1545 3UTR 100% 4.950 3.465 N ANKS6 n/a
9 TRCN0000139747 CTCCATCTGGAACTTCCACTA pLKO.1 1270 3UTR 100% 4.050 2.835 N ANKS6 n/a
10 TRCN0000139349 GAACAAGAGGTGGACATGGAA pLKO.1 1491 3UTR 100% 3.000 2.100 N ANKS6 n/a
11 TRCN0000144021 CAATTCTGGAAACTTCAACCA pLKO.1 983 3UTR 100% 2.640 1.848 N ANKS6 n/a
12 TRCN0000139664 CACTCTTCCTTTGAGAGCAGT pLKO.1 1659 3UTR 100% 2.640 1.848 N ANKS6 n/a
13 TRCN0000140121 GAGTGACAAGCTGAAAGCAGT pLKO.1 755 3UTR 100% 2.640 1.848 N ANKS6 n/a
14 TRCN0000143484 GAATTAAGACAGATGGGTCCA pLKO.1 1552 3UTR 100% 2.160 1.512 N ANKS6 n/a
15 TRCN0000143664 CACTTGAGAAATATCAGCCCA pLKO.1 1462 3UTR 100% 0.660 0.462 N ANKS6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001746230.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13400 pDONR223 100% 50.7% None 1_305del;1035G>A;1719_2783del n/a
Download CSV