Transcript: Human XR_001747081.2

PREDICTED: Homo sapiens HECT and RLD domain containing E3 ubiquitin protein ligase 4 (HERC4), transcript variant X13, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HERC4 (26091)
Length:
2389
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001747081.2
NBCI Gene record:
HERC4 (26091)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001747081.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364729 CTCATACGTTAGCGCTAAATG pLKO_005 570 3UTR 100% 13.200 18.480 N HERC4 n/a
2 TRCN0000034299 CGCAACAAGTTTGGTCAGCTA pLKO.1 1007 3UTR 100% 2.640 2.112 N HERC4 n/a
3 TRCN0000034301 CGGTTCAACAAGCAACAGGAA pLKO.1 1348 3UTR 100% 2.640 2.112 N HERC4 n/a
4 TRCN0000369551 TGGGCAGTGTCTACCAGATAT pLKO_005 1408 3UTR 100% 13.200 9.240 N HERC4 n/a
5 TRCN0000369552 TTAGCAATGATGATCACTATA pLKO_005 1689 3UTR 100% 13.200 7.920 N HERC4 n/a
6 TRCN0000040639 CCAATGAGATAGATGGAACAT pLKO.1 1629 3UTR 100% 4.950 3.465 N Herc4 n/a
7 TRCN0000324052 CCAATGAGATAGATGGAACAT pLKO_005 1629 3UTR 100% 4.950 3.465 N Herc4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001747081.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02913 pDONR223 100% 53.3% None (many diffs) n/a
2 ccsbBroad304_02913 pLX_304 0% 53.3% V5 (many diffs) n/a
3 TRCN0000470694 GCTTGAAGCTGGCGCGCCCGTGAT pLX_317 11.2% 53.3% V5 (many diffs) n/a
Download CSV