Transcript: Human XR_001747119.2

PREDICTED: Homo sapiens cyclin and CBS domain divalent metal cation transport mediator 2 (CNNM2), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CNNM2 (54805)
Length:
3608
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001747119.2
NBCI Gene record:
CNNM2 (54805)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001747119.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045236 GCACCGTCTATAACCGGGAAA pLKO.1 1405 3UTR 100% 4.050 5.670 N CNNM2 n/a
2 TRCN0000452962 CGCTATGCTGGAAGAATTTAA pLKO_005 1784 3UTR 100% 15.000 10.500 N CNNM2 n/a
3 TRCN0000045235 CCGGGAACGAAAGCAAGATTT pLKO.1 1985 3UTR 100% 13.200 9.240 N CNNM2 n/a
4 TRCN0000451474 GACAGTGAGATGAAGGTTAAA pLKO_005 2025 3UTR 100% 13.200 9.240 N CNNM2 n/a
5 TRCN0000045237 GCAGCAATAACCAGCTCAATT pLKO.1 2517 3UTR 100% 13.200 9.240 N CNNM2 n/a
6 TRCN0000045233 GCCCAAATAGAATCATGTTTA pLKO.1 3059 3UTR 100% 13.200 7.920 N CNNM2 n/a
7 TRCN0000045234 CCCAGTCTTCAGACAGTGAAA pLKO.1 2661 3UTR 100% 4.950 2.970 N CNNM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001747119.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08409 pDONR223 100% 45.5% None (many diffs) n/a
2 ccsbBroad304_08409 pLX_304 0% 45.5% V5 (many diffs) n/a
3 TRCN0000480940 CATGTGCACTTAGTAGCCCGGATT pLX_317 24.7% 45.5% V5 (many diffs) n/a
Download CSV