Transcript: Human XR_001747209.1

PREDICTED: Homo sapiens hexokinase domain containing 1 (HKDC1), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HKDC1 (80201)
Length:
3813
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001747209.1
NBCI Gene record:
HKDC1 (80201)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001747209.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078724 CCTTGCTAATACAAGAGAGAT pLKO.1 1177 3UTR 100% 4.950 6.930 N HKDC1 n/a
2 TRCN0000078727 GCCTTGCTAATACAAGAGAGA pLKO.1 1176 3UTR 100% 2.640 2.112 N HKDC1 n/a
3 TRCN0000299727 GCCTTGCTAATACAAGAGAGA pLKO_005 1176 3UTR 100% 2.640 2.112 N HKDC1 n/a
4 TRCN0000380275 ACATTGTTGCAGTCGTGAATG pLKO_005 2079 3UTR 100% 10.800 7.560 N HKDC1 n/a
5 TRCN0000361995 TCAAGAGGAGAAACGAGTTTG pLKO_005 2052 3UTR 100% 10.800 7.560 N Hkdc1 n/a
6 TRCN0000379520 TCAAGAGGAGAAACGAGTTTG pLKO_005 2052 3UTR 100% 10.800 7.560 N HKDC1 n/a
7 TRCN0000078725 CCCTCGATGTGATGTGACATT pLKO.1 2910 3UTR 100% 4.950 3.465 N HKDC1 n/a
8 TRCN0000310497 CCCTCGATGTGATGTGACATT pLKO_005 2910 3UTR 100% 4.950 3.465 N HKDC1 n/a
9 TRCN0000078723 CCTGTACTTGTGGATGAACAT pLKO.1 3431 3UTR 100% 4.950 3.465 N HKDC1 n/a
10 TRCN0000299726 CCTGTACTTGTGGATGAACAT pLKO_005 3431 3UTR 100% 4.950 3.465 N HKDC1 n/a
11 TRCN0000078726 GCAGATGGAGAGTCAGTTCTA pLKO.1 448 3UTR 100% 4.950 3.465 N HKDC1 n/a
12 TRCN0000310499 GCAGATGGAGAGTCAGTTCTA pLKO_005 448 3UTR 100% 4.950 3.465 N HKDC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001747209.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16002 pDONR223 0% 33.5% None (many diffs) n/a
2 ccsbBroad304_16002 pLX_304 0% 33.5% V5 (many diffs) n/a
3 TRCN0000474904 AGTGTCAATTGTCCCAGGATATAG pLX_317 31% 33.5% V5 (many diffs) n/a
4 ccsbBroadEn_15165 pDONR223 0% 33.5% None (many diffs) n/a
5 ccsbBroad304_15165 pLX_304 0% 33.5% V5 (many diffs) n/a
6 TRCN0000480216 CCAAGCAGCCGCGCCGCGACTCTC pLX_317 28.9% 33.5% V5 (many diffs) n/a
Download CSV