Transcript: Human XR_001747233.1

PREDICTED: Homo sapiens pyridine nucleotide-disulphide oxidoreductase domain 2 (PYROXD2), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PYROXD2 (84795)
Length:
2143
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001747233.1
NBCI Gene record:
PYROXD2 (84795)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001747233.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419431 TTGATTGCATCGAGGTCTATG pLKO_005 1498 3UTR 100% 10.800 15.120 N PYROXD2 n/a
2 TRCN0000064397 GCCGCAGATTTACACTGATCT pLKO.1 332 3UTR 100% 4.950 6.930 N PYROXD2 n/a
3 TRCN0000064394 CCCGATATTATGAGGTCCTCA pLKO.1 697 3UTR 100% 2.640 3.696 N PYROXD2 n/a
4 TRCN0000064393 GCCCAGGTCTTTCCCAAATAT pLKO.1 513 3UTR 100% 15.000 10.500 N PYROXD2 n/a
5 TRCN0000438104 AGCAGGAGAGAGACGCTTATG pLKO_005 1465 3UTR 100% 10.800 7.560 N PYROXD2 n/a
6 TRCN0000064396 CAAGGAGTTGTGCTGGAAGAT pLKO.1 1014 3UTR 100% 4.950 3.465 N PYROXD2 n/a
7 TRCN0000064395 CACCACCAGATTTGGAGAGAA pLKO.1 1561 3UTR 100% 4.950 3.465 N PYROXD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001747233.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09223 pDONR223 100% 81.1% None (many diffs) n/a
2 ccsbBroad304_09223 pLX_304 0% 81.1% V5 (many diffs) n/a
3 TRCN0000468691 AGTACTCCTAGATACCCCTTAACC pLX_317 24.8% 81.1% V5 (many diffs) n/a
Download CSV