Transcript: Human XR_001747822.2

PREDICTED: Homo sapiens sorting nexin 32 (SNX32), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SNX32 (254122)
Length:
2112
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001747822.2
NBCI Gene record:
SNX32 (254122)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001747822.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432440 GTCGAGACCACAACTTCTTTG pLKO_005 562 3UTR 100% 10.800 15.120 N SNX32 n/a
2 TRCN0000431563 GACATGCTGAGGTACTACATG pLKO_005 872 3UTR 100% 4.950 6.930 N SNX32 n/a
3 TRCN0000432752 CTCCTTACAGGTGGAGATTTC pLKO_005 179 3UTR 100% 10.800 7.560 N SNX32 n/a
4 TRCN0000147674 GCCATCTTTAAGAAGACAGTT pLKO.1 492 3UTR 100% 4.950 3.465 N SNX32 n/a
5 TRCN0000148010 GACAAGGTGAAATTCACTGTT pLKO.1 219 3UTR 100% 4.950 2.970 N SNX32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001747822.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16135 pDONR223 0% 48.4% None (many diffs) n/a
2 ccsbBroad304_16135 pLX_304 0% 48.4% V5 (many diffs) n/a
3 TRCN0000471625 CGAGCCCGAAAGTTCCTGTAATAT pLX_317 39.4% 48.4% V5 (many diffs) n/a
4 ccsbBroadEn_09895 pDONR223 100% 48.3% None (many diffs) n/a
5 ccsbBroad304_09895 pLX_304 0% 48.3% V5 (many diffs) n/a
6 TRCN0000467330 AACTCGTTTTTGTACTACGACACG pLX_317 33.2% 48.3% V5 (many diffs) n/a
Download CSV