Transcript: Human XR_001747969.2

PREDICTED: Homo sapiens ALG9 alpha-1,2-mannosyltransferase (ALG9), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ALG9 (79796)
Length:
2723
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001747969.2
NBCI Gene record:
ALG9 (79796)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001747969.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034723 CCAACACACTACCTCATCTAT pLKO.1 356 3UTR 100% 5.625 7.875 N ALG9 n/a
2 TRCN0000294152 GTCATTGACAGCTACTATTAT pLKO_005 890 3UTR 100% 15.000 12.000 N ALG9 n/a
3 TRCN0000294150 TCCCTGTGTATCCACTTATAT pLKO_005 1083 3UTR 100% 15.000 10.500 N ALG9 n/a
4 TRCN0000374508 GGTCATTGACAGCTACTATTA pLKO_005 889 3UTR 100% 13.200 9.240 N Alg9 n/a
5 TRCN0000034721 GCAAAGCAAATCAGGAAGAAA pLKO.1 1790 3UTR 100% 5.625 3.938 N ALG9 n/a
6 TRCN0000034722 CCCTTGATTTGTATCCAGAAT pLKO.1 1302 3UTR 100% 4.950 3.465 N ALG9 n/a
7 TRCN0000286819 CCCTTGATTTGTATCCAGAAT pLKO_005 1302 3UTR 100% 4.950 3.465 N ALG9 n/a
8 TRCN0000034719 GCTCCAATGTATATTTGGTTT pLKO.1 1019 3UTR 100% 4.950 3.465 N ALG9 n/a
9 TRCN0000286820 GCTCCAATGTATATTTGGTTT pLKO_005 1019 3UTR 100% 4.950 3.465 N ALG9 n/a
10 TRCN0000034720 GCTGCATTTCATGCAAGAATT pLKO.1 458 3UTR 100% 0.000 0.000 N ALG9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001747969.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04128 pDONR223 100% 60.7% None 1_88del;980_981ins123;1818_2723delinsGT n/a
2 ccsbBroad304_04128 pLX_304 0% 60.7% V5 1_88del;980_981ins123;1818_2723delinsGT n/a
3 TRCN0000474722 TATCTAAGCAAAACTACTGACCCT pLX_317 23.2% 60.7% V5 1_88del;980_981ins123;1818_2723delinsGT n/a
Download CSV