Transcript: Human XR_001748001.2

PREDICTED: Homo sapiens BTB domain containing 10 (BTBD10), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BTBD10 (84280)
Length:
2580
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001748001.2
NBCI Gene record:
BTBD10 (84280)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001748001.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413002 GAGCGATTCTGGATTACTATA pLKO_005 922 3UTR 100% 13.200 18.480 N BTBD10 n/a
2 TRCN0000422621 CAAGTACTTCCTCGCGTATTG pLKO_005 343 3UTR 100% 10.800 15.120 N BTBD10 n/a
3 TRCN0000168331 GAAGGTTATCCTACCTACAAA pLKO.1 1455 3UTR 100% 5.625 7.875 N BTBD10 n/a
4 TRCN0000217926 GAGAATTGGGATCGGAAATTG pLKO.1 291 3UTR 100% 13.200 10.560 N Btbd10 n/a
5 TRCN0000251937 GAGAATTGGGATCGGAAATTG pLKO_005 291 3UTR 100% 13.200 10.560 N Btbd10 n/a
6 TRCN0000436499 GAGAATTGGGATCGGAAATTG pLKO_005 291 3UTR 100% 13.200 10.560 N BTBD10 n/a
7 TRCN0000421015 GTATTCCTCCAGTACAATTTG pLKO_005 2233 3UTR 100% 13.200 9.240 N BTBD10 n/a
8 TRCN0000413953 TATAGTTGTGATGCACAATAT pLKO_005 2191 3UTR 100% 13.200 9.240 N BTBD10 n/a
9 TRCN0000426826 ACGAGATTCATCTCATGAAAG pLKO_005 458 3UTR 100% 10.800 7.560 N BTBD10 n/a
10 TRCN0000168451 GAAACAGTAGTCAGTCAAGTT pLKO.1 640 3UTR 100% 4.950 3.465 N BTBD10 n/a
11 TRCN0000168717 GAGTGACACTAATAGTGGATA pLKO.1 748 3UTR 100% 4.950 3.465 N BTBD10 n/a
12 TRCN0000167507 GCACATAACAATGTTTAGGAT pLKO.1 1867 3UTR 100% 3.000 2.100 N BTBD10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001748001.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12801 pDONR223 100% 21.3% None 1_1118del;1252_1347del;1767_2580del n/a
2 ccsbBroad304_12801 pLX_304 0% 21.3% V5 1_1118del;1252_1347del;1767_2580del n/a
3 TRCN0000465665 AAACGACCTCCGCTAAAGCCTCCC pLX_317 54.8% 21.3% V5 1_1118del;1252_1347del;1767_2580del n/a
Download CSV