Transcript: Human XR_001748035.1

PREDICTED: Homo sapiens alkB homolog 8, tRNA methyltransferase (ALKBH8), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ALKBH8 (91801)
Length:
3784
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001748035.1
NBCI Gene record:
ALKBH8 (91801)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001748035.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330599 TTACCTGAACACATCATATAT pLKO_005 1857 3UTR 100% 15.000 21.000 N ALKBH8 n/a
2 TRCN0000149780 GCCGTACTCATTTGCAAGATA pLKO.1 354 3UTR 100% 5.625 7.875 N ALKBH8 n/a
3 TRCN0000275540 GCCGTACTCATTTGCAAGATA pLKO_005 354 3UTR 100% 5.625 7.875 N ALKBH8 n/a
4 TRCN0000129479 GCCAATGGTGGTTTGGGTAAT pLKO.1 256 3UTR 100% 10.800 8.640 N ALKBH8 n/a
5 TRCN0000330638 CAGGTGGGAAGGCACTCATTT pLKO_005 1341 3UTR 100% 13.200 9.240 N ALKBH8 n/a
6 TRCN0000149425 CCAGTGATGTTGGAGACTTAA pLKO.1 1055 3UTR 100% 13.200 9.240 N ALKBH8 n/a
7 TRCN0000275541 CCAGTGATGTTGGAGACTTAA pLKO_005 1055 3UTR 100% 13.200 9.240 N ALKBH8 n/a
8 TRCN0000128311 GAAAGTGTTGATTGGACAGAA pLKO.1 574 3UTR 100% 4.950 3.465 N ALKBH8 n/a
9 TRCN0000148178 GAAGAATCTAAGAGAGCCTAT pLKO.1 385 3UTR 100% 4.050 2.835 N ALKBH8 n/a
10 TRCN0000146522 CGCATTAATGACTCTCAGGAA pLKO.1 1532 3UTR 100% 2.640 1.848 N ALKBH8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001748035.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14340 pDONR223 100% 18.8% None (many diffs) n/a
2 ccsbBroad304_14340 pLX_304 0% 18.8% V5 (many diffs) n/a
3 TRCN0000471208 TTATACCTCTCCTCCCATAGCCAG pLX_317 75.3% 18.8% V5 (many diffs) n/a
Download CSV