Transcript: Human XR_001748867.1

PREDICTED: Homo sapiens calcium voltage-gated channel auxiliary subunit beta 3 (CACNB3), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CACNB3 (784)
Length:
2783
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001748867.1
NBCI Gene record:
CACNB3 (784)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001748867.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044067 GAGTGAGATCGAGCGCATATT pLKO.1 1039 3UTR 100% 13.200 18.480 N CACNB3 n/a
2 TRCN0000418082 AGCGATCTGTGCTCAACAATC pLKO_005 838 3UTR 100% 10.800 15.120 N CACNB3 n/a
3 TRCN0000438942 AGGTACTCCAGCGTCTCATTC pLKO_005 1179 3UTR 100% 10.800 15.120 N CACNB3 n/a
4 TRCN0000044064 CCCATCATCGTCTTTGTCAAA pLKO.1 1145 3UTR 100% 4.950 3.465 N CACNB3 n/a
5 TRCN0000044063 CCGGAGTCATTTGATGTGATT pLKO.1 1274 3UTR 100% 4.950 3.465 N CACNB3 n/a
6 TRCN0000044066 GACCGTACAGATGATGGCATA pLKO.1 1231 3UTR 100% 4.050 2.835 N CACNB3 n/a
7 TRCN0000044065 TGGAGTCAACTTTGAGGCCAA pLKO.1 413 3UTR 100% 2.160 1.512 N CACNB3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001748867.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05925 pDONR223 100% 52.1% None (many diffs) n/a
2 ccsbBroad304_05925 pLX_304 0% 52.1% V5 (many diffs) n/a
3 TRCN0000476911 CTGCCCCGCTGACCGATGTCCGAT pLX_317 23.6% 52.1% V5 (many diffs) n/a
Download CSV