Transcript: Human XR_001748893.2

PREDICTED: Homo sapiens methyltransferase like 25 (METTL25), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
METTL25 (84190)
Length:
2016
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001748893.2
NBCI Gene record:
METTL25 (84190)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001748893.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437412 GATGGTGCTGTGGTCGTAATG pLKO_005 1455 3UTR 100% 10.800 15.120 N METTL25 n/a
2 TRCN0000168716 GCTTGGATTAGATGAGTCCAA pLKO.1 1598 3UTR 100% 0.264 0.211 N METTL25 n/a
3 TRCN0000413705 CTTTGCTCTGGCTGCGAAATA pLKO_005 387 3UTR 100% 13.200 9.240 N METTL25 n/a
4 TRCN0000412811 GAACTACTACGAGAAGTATAA pLKO_005 1640 3UTR 100% 13.200 9.240 N METTL25 n/a
5 TRCN0000424747 TCCATTGAAGCAAATTATTAG pLKO_005 1862 3UTR 100% 13.200 9.240 N METTL25 n/a
6 TRCN0000413469 GATTCTTCTGGATCGACTTTG pLKO_005 1730 3UTR 100% 10.800 7.560 N METTL25 n/a
7 TRCN0000417659 ACCTGTTGCTGAGATTGCTTT pLKO_005 1900 3UTR 100% 4.950 3.465 N METTL25 n/a
8 TRCN0000172584 GATGCCCTGTCCATTTCCAAT pLKO.1 151 3UTR 100% 4.950 3.465 N METTL25 n/a
9 TRCN0000168573 GCTGATACTGAGGAAGTGTTT pLKO.1 832 3UTR 100% 4.950 3.465 N METTL25 n/a
10 TRCN0000168738 GAAGTTGTTTGATCCCGTGAA pLKO.1 1793 3UTR 100% 4.050 2.835 N METTL25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001748893.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09156 pDONR223 100% 82.9% None (many diffs) n/a
2 ccsbBroad304_09156 pLX_304 0% 82.9% V5 (many diffs) n/a
3 TRCN0000472945 CCCTTGTTACGGGATAATCAATTC pLX_317 19.2% 82.9% V5 (many diffs) n/a
Download CSV