Transcript: Human XR_001748932.1

PREDICTED: Homo sapiens RNA binding motif protein 19 (RBM19), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RBM19 (9904)
Length:
3676
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001748932.1
NBCI Gene record:
RBM19 (9904)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001748932.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005067 CCCAGGATGTACTCTGTTTAT pLKO.1 2253 3UTR 100% 13.200 18.480 N RBM19 n/a
2 TRCN0000005068 CGGACATGGATTACCTGAAAT pLKO.1 761 3UTR 100% 13.200 18.480 N RBM19 n/a
3 TRCN0000273131 ACTAAGCCAGCCGTGACATTG pLKO_005 2509 3UTR 100% 10.800 15.120 N RBM19 n/a
4 TRCN0000273129 ACTCTACTACTCCAGAAATTA pLKO_005 458 3UTR 100% 15.000 10.500 N RBM19 n/a
5 TRCN0000273197 ATGGCAAGTTCCGCAAGTTTG pLKO_005 257 3UTR 100% 10.800 7.560 N RBM19 n/a
6 TRCN0000005069 CCGTTCAATGTCACAGAGAAA pLKO.1 1048 3UTR 100% 4.950 3.465 N RBM19 n/a
7 TRCN0000005070 GCCTATTCCAAGTTCCATCAT pLKO.1 1999 3UTR 100% 4.950 3.465 N RBM19 n/a
8 TRCN0000273200 GCCTATTCCAAGTTCCATCAT pLKO_005 1999 3UTR 100% 4.950 3.465 N RBM19 n/a
9 TRCN0000177221 GAGGAAGAAGAAGAAGAGATA pLKO.1 2230 3UTR 100% 4.950 2.475 Y Cnpy4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001748932.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07508 pDONR223 100% 74.7% None (many diffs) n/a
2 ccsbBroad304_07508 pLX_304 0% 74.7% V5 (many diffs) n/a
3 TRCN0000478301 TGCTCACCATTTGTTTCAGCACGC pLX_317 10.6% 74.7% V5 (many diffs) n/a
Download CSV